Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSME4 cdna clone

PSME4 cDNA Clone

Gene Names
PSME4; PA200
Synonyms
PSME4; PSME4 cDNA Clone; PSME4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcaggggttgctttaccctcatcaagtgcctttggtacttcaggtgctaaaacaaacagcaagaagcagttcttggcatgcacgatacacagtactgacctacctccagaccatggtattttataacctctttattttcctaaacaatgaagatgcagttaaagatatcaggtggctggttataagtcttttggaggacgaacaactggaggttcgagaaatggctgctactaccttaagcggtctgctacagtgtaactttcttaccatggacagtcctatgcagattcattttgagcaactttgcaaaacaaaactacctaagaaaagaaagcgagaccctggttctgtaggagataccattccttctgcagagttggtcaaacgccatgctggggtgctaggacttggtgcatgtgttctttctagtccttacgatgttcccacctggatgccccagctcctcatgaatctcagtgcacatctaaatgatcctcagcctattgagatgactgtaaaaaaaaccttatccaatttccgaaggactcaccatgacaactggcaggaacataaacagcaattcactgatgaccaactgcttgttctcaccgatcttcttgtgtcaccatgctattatgcatag
Sequence Length
648
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,699 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) activator subunit 4, mRNA
NCBI Official Synonym Full Names
proteasome activator subunit 4
NCBI Official Symbol
PSME4
NCBI Official Synonym Symbols
PA200
NCBI Protein Information
proteasome activator complex subunit 4
UniProt Protein Name
Proteasome activator complex subunit 4
UniProt Gene Name
PSME4
UniProt Synonym Gene Names
KIAA0077
UniProt Entry Name
PSME4_HUMAN

Uniprot Description

PSME4: Activates proteasomal cleavage of peptides in an energy- independent manner. May be involved in spermatogenesis. May be involved in DNA repair. 4 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 2p16.2

Cellular Component: cytosol; nucleus

Molecular Function: protease activator activity; protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; DNA repair; MAPKKK cascade; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; proteasomal ubiquitin-independent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; response to DNA damage stimulus; spermatogenesis, exchange of chromosomal proteins; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSME4

Similar Products

Product Notes

The PSME4 psme4 (Catalog #AAA1276489) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcagg ggttgcttta ccctcatcaa gtgcctttgg tacttcaggt gctaaaacaa acagcaagaa gcagttcttg gcatgcacga tacacagtac tgacctacct ccagaccatg gtattttata acctctttat tttcctaaac aatgaagatg cagttaaaga tatcaggtgg ctggttataa gtcttttgga ggacgaacaa ctggaggttc gagaaatggc tgctactacc ttaagcggtc tgctacagtg taactttctt accatggaca gtcctatgca gattcatttt gagcaacttt gcaaaacaaa actacctaag aaaagaaagc gagaccctgg ttctgtagga gataccattc cttctgcaga gttggtcaaa cgccatgctg gggtgctagg acttggtgca tgtgttcttt ctagtcctta cgatgttccc acctggatgc cccagctcct catgaatctc agtgcacatc taaatgatcc tcagcctatt gagatgactg taaaaaaaac cttatccaat ttccgaagga ctcaccatga caactggcag gaacataaac agcaattcac tgatgaccaa ctgcttgttc tcaccgatct tcttgtgtca ccatgctatt atgcatag. It is sometimes possible for the material contained within the vial of "PSME4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.