Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD4 cdna clone

PSMD4 cDNA Clone

Gene Names
PSMD4; AF; ASF; S5A; AF-1; MCB1; Rpn10; pUB-R5
Synonyms
PSMD4; PSMD4 cDNA Clone; PSMD4 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgttggaaagcactatggtgtgtgtggacaacagtgagtatatgcggaatggagacttcttacccaccaggctgcaggcccagcaggatgctgtcaacatagtttgtcattcaaagacccgcagcaaccctgagaacaacgtgggccttatcacactggctaatgactgtgaagtgctgaccacactcaccccagacactggccgtatcctgtccaagctacatactgtccaacccaagggcaagatcaccttctgcacgggcatccgcgtggcccatctggctctgaagcaccgacaaggcaagaatcacaagatgcgcatcattgcctttgtgggaagcccagtggaggacaatgagaaggatctggtgaaactggctaaacgcctcaagaaggagaaagtaaatgttgacattatcaattttggggaagaggaggtgaacacagaaaagctgacagcctttgtaaacacgttgaatggcaaagatggaaccggttctcatctggtgacagtgcctcctgggcccagtttggctgatgctctcatcagttctccgattttggctggtgaaggtggtgccatgctgggtcttggtgccagtgactttgaatttggagtagatcccagtgctgatcctgagctggccttggcccttcgtgtatctatggaagagcagcggcagcggcaggaggaggaggcccggcgggcagctgcagcttctgctgctgaggccgggattgctacgactgggactgaagactcagacgatgccctgctgaagatgaccatcagccagcaagagtttggccgcactgggcttcctgacctaagcagtatgactgaggaagagcagattgcttatgccatgcagatgtccctgcagggagcagagtttggccaggcggaatcagcagacattgatgccagctcagctatggacacatctgagccagccaaggaggaggatgattacgacgtgatgcaggaccccgagttccttcagagtgtcctagagaacctcccaggtgtggatcccaacaatgaagccattcgaaatgctatgggctccctggcctcccaggccaccaaggacggcaagaaggacaagaaggaggaagacaagaagtga
Sequence Length
1134
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,612 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, non-ATPase 4
NCBI Official Symbol
PSMD4
NCBI Official Synonym Symbols
AF; ASF; S5A; AF-1; MCB1; Rpn10; pUB-R5
NCBI Protein Information
26S proteasome non-ATPase regulatory subunit 4
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 4
UniProt Gene Name
PSMD4
UniProt Synonym Gene Names
MCB1; AF; ASF
UniProt Entry Name
PSMD4_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. Pseudogenes have been identified on chromosomes 10 and 21. [provided by RefSeq, Jul 2008]

Uniprot Description

PSMD4: Binds and presumably selects ubiquitin-conjugates for destruction. Displays selectivity for longer polyubiquitin chains. Modulates intestinal fluid secretion. The 26S proteasome is composed of a core protease, known as the 20S proteasome, capped at one or both ends by the 19S regulatory complex (RC). The RC is composed of at least 18 different subunits in two subcomplexes, the base and the lid, which form the portions proximal and distal to the 20S proteolytic core, respectively. Directly interacts with NUB1. Interacts with SQSTM1. Interacts with UBQLN4. Belongs to the proteasome subunit S5A family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; Proteasome complex

Chromosomal Location of Human Ortholog: 1q21.3

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; proteasome complex

Molecular Function: identical protein binding; polyubiquitin binding; protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; proteasome assembly; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMD4

Similar Products

Product Notes

The PSMD4 psmd4 (Catalog #AAA1278930) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgttgg aaagcactat ggtgtgtgtg gacaacagtg agtatatgcg gaatggagac ttcttaccca ccaggctgca ggcccagcag gatgctgtca acatagtttg tcattcaaag acccgcagca accctgagaa caacgtgggc cttatcacac tggctaatga ctgtgaagtg ctgaccacac tcaccccaga cactggccgt atcctgtcca agctacatac tgtccaaccc aagggcaaga tcaccttctg cacgggcatc cgcgtggccc atctggctct gaagcaccga caaggcaaga atcacaagat gcgcatcatt gcctttgtgg gaagcccagt ggaggacaat gagaaggatc tggtgaaact ggctaaacgc ctcaagaagg agaaagtaaa tgttgacatt atcaattttg gggaagagga ggtgaacaca gaaaagctga cagcctttgt aaacacgttg aatggcaaag atggaaccgg ttctcatctg gtgacagtgc ctcctgggcc cagtttggct gatgctctca tcagttctcc gattttggct ggtgaaggtg gtgccatgct gggtcttggt gccagtgact ttgaatttgg agtagatccc agtgctgatc ctgagctggc cttggccctt cgtgtatcta tggaagagca gcggcagcgg caggaggagg aggcccggcg ggcagctgca gcttctgctg ctgaggccgg gattgctacg actgggactg aagactcaga cgatgccctg ctgaagatga ccatcagcca gcaagagttt ggccgcactg ggcttcctga cctaagcagt atgactgagg aagagcagat tgcttatgcc atgcagatgt ccctgcaggg agcagagttt ggccaggcgg aatcagcaga cattgatgcc agctcagcta tggacacatc tgagccagcc aaggaggagg atgattacga cgtgatgcag gaccccgagt tccttcagag tgtcctagag aacctcccag gtgtggatcc caacaatgaa gccattcgaa atgctatggg ctccctggcc tcccaggcca ccaaggacgg caagaaggac aagaaggagg aagacaagaa gtga. It is sometimes possible for the material contained within the vial of "PSMD4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.