Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD3 cdna clone

PSMD3 cDNA Clone

Gene Names
PSMD3; S3; P58; RPN3; TSTA2
Synonyms
PSMD3; PSMD3 cDNA Clone; PSMD3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcaggagggctcggcgcggcgccgcggcgcggacaaggcgaaaccgccgcccggcggaggagaacaagaacccccaccgccgccggccccccaggatgtggagatgaaagaggaggcagcgacgggtggcgggtcgacgggggaggcagacggcaagacggcggcggcagcggctgagcactcccagcgagagctggacacagtcaccttggaggacatcaaggagcacgtgaaacagctagagaaagcggtttcaggcaaggagccgagattcgtgctgcgggccctgcggatgctgccttccacatcacgccgcctcaaccactatgttctgtataaggctgtgcagggcttcttcacttcaaataatgccactcgagactttttgctccccttcctggaagagcccatggacacagaggctgatttacagttccgtccccgcacgggaaaagctgcgtcgacacccctcctgcctgaagtggaagcctatctccaactcctcgtggtcatcttcatgatgaacagcaagcgctacaaagaggcacagaagatctctgatgatctgatgcagaagatcagtactcagaaccgccgggccctagaccttgtagccgcaaagtgttactattatcacgcccgggtctatgagttcctggacaagctggatgtggtgcgcagcttcttgcatgctcggctccggacagctacgcttcggcatgacgcagacgggcaggccaccctgttgaacctcctgctgcggaattacctacactacagcttgtacgaccaggctgagaagctggtgtccaagtctgtgttcccagagcaggccaacaacaatgagtgggccaggtacctctactacacagggcgaatcaaagccatccagctggagtactcagaggcccggagaacgatgaccaacgcccttcgcaaggcccctcagcacacagctgtcggcttcaaacagacggtgcacaagcttctcatcgtggtggagctgttgctgggggagatccctgaccggctgcagttccgccagccctccctcaagcgctcactcatgccctatttccttctgactcaagctgtcaggacaggaaacctagccaagttcaaccaggtcctggatcagtttggggagaagtttcaagcagatgggacctacaccctaattatccggctgcggcacaacgtgattaagacaggtgtacgcatgatcagcctctcctattcccgaatctccttggctgacatcgcccagaagctgcagttggatagccccgaagatgcagagttcattgttgccaaggccatccgggatggtgtcattgaggccagcatcaaccacgagaagggctatgtccaatccaaggagatgattgacatctattccacccgagagccccagctagccttccaccagcgcatctccttctgcctagatatccacaacatgtctgtcaaggccatgaggtttcctcccaaatcgtacaacaaggacttggagtctgcagaggaacggcgtgagcgagaacagcaggacttggagtttgccaaggagatggcagaagatgatgatgacagcttcccttga
Sequence Length
1605
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,184 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 3, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, non-ATPase 3
NCBI Official Symbol
PSMD3
NCBI Official Synonym Symbols
S3; P58; RPN3; TSTA2
NCBI Protein Information
26S proteasome non-ATPase regulatory subunit 3
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 3
UniProt Gene Name
PSMD3
UniProt Entry Name
PSMD3_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S3 family that functions as one of the non-ATPase subunits of the 19S regulator lid. Single nucleotide polymorphisms in this gene are associated with neutrophil count. [provided by RefSeq, Jul 2012]

Uniprot Description

PSMD3: Acts as a regulatory subunit of the 26 proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins. Belongs to the proteasome subunit S3 family.

Protein type: Proteasome complex; Protease

Chromosomal Location of Human Ortholog: 17q21.1

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; nucleus; proteasome complex

Molecular Function: protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; ubiquitin-dependent protein catabolic process; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMD3

Similar Products

Product Notes

The PSMD3 psmd3 (Catalog #AAA1265712) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcagg agggctcggc gcggcgccgc ggcgcggaca aggcgaaacc gccgcccggc ggaggagaac aagaaccccc accgccgccg gccccccagg atgtggagat gaaagaggag gcagcgacgg gtggcgggtc gacgggggag gcagacggca agacggcggc ggcagcggct gagcactccc agcgagagct ggacacagtc accttggagg acatcaagga gcacgtgaaa cagctagaga aagcggtttc aggcaaggag ccgagattcg tgctgcgggc cctgcggatg ctgccttcca catcacgccg cctcaaccac tatgttctgt ataaggctgt gcagggcttc ttcacttcaa ataatgccac tcgagacttt ttgctcccct tcctggaaga gcccatggac acagaggctg atttacagtt ccgtccccgc acgggaaaag ctgcgtcgac acccctcctg cctgaagtgg aagcctatct ccaactcctc gtggtcatct tcatgatgaa cagcaagcgc tacaaagagg cacagaagat ctctgatgat ctgatgcaga agatcagtac tcagaaccgc cgggccctag accttgtagc cgcaaagtgt tactattatc acgcccgggt ctatgagttc ctggacaagc tggatgtggt gcgcagcttc ttgcatgctc ggctccggac agctacgctt cggcatgacg cagacgggca ggccaccctg ttgaacctcc tgctgcggaa ttacctacac tacagcttgt acgaccaggc tgagaagctg gtgtccaagt ctgtgttccc agagcaggcc aacaacaatg agtgggccag gtacctctac tacacagggc gaatcaaagc catccagctg gagtactcag aggcccggag aacgatgacc aacgcccttc gcaaggcccc tcagcacaca gctgtcggct tcaaacagac ggtgcacaag cttctcatcg tggtggagct gttgctgggg gagatccctg accggctgca gttccgccag ccctccctca agcgctcact catgccctat ttccttctga ctcaagctgt caggacagga aacctagcca agttcaacca ggtcctggat cagtttgggg agaagtttca agcagatggg acctacaccc taattatccg gctgcggcac aacgtgatta agacaggtgt acgcatgatc agcctctcct attcccgaat ctccttggct gacatcgccc agaagctgca gttggatagc cccgaagatg cagagttcat tgttgccaag gccatccggg atggtgtcat tgaggccagc atcaaccacg agaagggcta tgtccaatcc aaggagatga ttgacatcta ttccacccga gagccccagc tagccttcca ccagcgcatc tccttctgcc tagatatcca caacatgtct gtcaaggcca tgaggtttcc tcccaaatcg tacaacaagg acttggagtc tgcagaggaa cggcgtgagc gagaacagca ggacttggag tttgccaagg agatggcaga agatgatgat gacagcttcc cttga. It is sometimes possible for the material contained within the vial of "PSMD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.