Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD12 cdna clone

PSMD12 cDNA Clone

Gene Names
PSMD12; p55; Rpn5
Synonyms
PSMD12; PSMD12 cDNA Clone; PSMD12 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggacggcggctcggagcgggctgacgggcgcatcgtcaagatggaggtggactacagcgccacggtggatcagcgcctacccgagtgtgcgaagctagccaaggaaggaagacttcaagaagtcattgaaacccttctctctctggaaaagcagactcgtactgcttccgatatggtatcgacatcccgtatcttagttgcagtagtgaagatgtgctatgaggctaaagaatgggatttacttaatgaaaatattatgcttttgtccaaaaggcggagtcagttaaaacaagctgttgccaaaatggttcaacagtgctgtacttatgttgaggaaatcacagaccttcctatcaaacttcgattaattgatactctacgaatggttaccgaaggcaagatttatgttgaaattgagcgtgcgcgactgactaaaacattagcaactataaaagaacaaaatggtgatgtgaaagaggcagcctccattttacaggagttacaggtggaaacctacgggtcaatggaaaagaaagagcgagtggaatttattttggagcaaatgaggctctgcctagctgtgaaggattacattcgaacacaaatcatcagcaagaaaattaacaccaaatttttccaggaagaaaatacagagaaattaaagttgaagtactataatttaatgattcagctggatcaacatgagggatcctatttgtctatttgtaagcactacagagcaatatatgatactccctgtatacaggcagaaagtgaaaaatggcagcaggctctgaagagtgttgtactctatgttatcctggctccttttgacaatgaacagtcagatttggttcaccgaataagtggtgacaagaagttagaagaaattcccaaatacaaggatcttttaaagctttttaccacaatggagttgatgcgttggtccacacttgttgaggactatggaatggaattaagaaaaggttcccttgagagtcctgcaacggatgtttttggttctacagaggaaggtgaaaaaaggtggaaagacttgaagaacagagttgttgaacataatattagaataatggccaagtattatactcggataacaatgaaaaggatggcacagcttctggatctatctgttgatgagtccgaagcctttctctcaaatctagtagttaacaagaccatctttgctaaagtagacagattagcaggaattatcaacttccagagacccaaggatccaaataatttattaaatgactggtctcagaaactgaactcattaatgtctctggttaacaaaactacgcatctcatagccaaagaggagatgatacataatctacaataa
Sequence Length
1371
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,579 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 12, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, non-ATPase 12
NCBI Official Symbol
PSMD12
NCBI Official Synonym Symbols
p55; Rpn5
NCBI Protein Information
26S proteasome non-ATPase regulatory subunit 12
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 12
UniProt Gene Name
PSMD12
UniProt Entry Name
PSD12_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Uniprot Description

PSMD12: Acts as a regulatory subunit of the 26S proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins. Belongs to the proteasome subunit p55 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; Proteasome complex

Chromosomal Location of Human Ortholog: 17q24.2

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; proteasome complex; proteasome regulatory particle

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Similar Products

Product Notes

The PSMD12 psmd12 (Catalog #AAA1271480) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggacg gcggctcgga gcgggctgac gggcgcatcg tcaagatgga ggtggactac agcgccacgg tggatcagcg cctacccgag tgtgcgaagc tagccaagga aggaagactt caagaagtca ttgaaaccct tctctctctg gaaaagcaga ctcgtactgc ttccgatatg gtatcgacat cccgtatctt agttgcagta gtgaagatgt gctatgaggc taaagaatgg gatttactta atgaaaatat tatgcttttg tccaaaaggc ggagtcagtt aaaacaagct gttgccaaaa tggttcaaca gtgctgtact tatgttgagg aaatcacaga ccttcctatc aaacttcgat taattgatac tctacgaatg gttaccgaag gcaagattta tgttgaaatt gagcgtgcgc gactgactaa aacattagca actataaaag aacaaaatgg tgatgtgaaa gaggcagcct ccattttaca ggagttacag gtggaaacct acgggtcaat ggaaaagaaa gagcgagtgg aatttatttt ggagcaaatg aggctctgcc tagctgtgaa ggattacatt cgaacacaaa tcatcagcaa gaaaattaac accaaatttt tccaggaaga aaatacagag aaattaaagt tgaagtacta taatttaatg attcagctgg atcaacatga gggatcctat ttgtctattt gtaagcacta cagagcaata tatgatactc cctgtataca ggcagaaagt gaaaaatggc agcaggctct gaagagtgtt gtactctatg ttatcctggc tccttttgac aatgaacagt cagatttggt tcaccgaata agtggtgaca agaagttaga agaaattccc aaatacaagg atcttttaaa gctttttacc acaatggagt tgatgcgttg gtccacactt gttgaggact atggaatgga attaagaaaa ggttcccttg agagtcctgc aacggatgtt tttggttcta cagaggaagg tgaaaaaagg tggaaagact tgaagaacag agttgttgaa cataatatta gaataatggc caagtattat actcggataa caatgaaaag gatggcacag cttctggatc tatctgttga tgagtccgaa gcctttctct caaatctagt agttaacaag accatctttg ctaaagtaga cagattagca ggaattatca acttccagag acccaaggat ccaaataatt tattaaatga ctggtctcag aaactgaact cattaatgtc tctggttaac aaaactacgc atctcatagc caaagaggag atgatacata atctacaata a. It is sometimes possible for the material contained within the vial of "PSMD12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.