Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRUNE cdna clone

PRUNE cDNA Clone

Gene Names
PRUNE1; PRUNE; DRES17; HTCD37; DRES-17; H-PRUNE
Synonyms
PRUNE; PRUNE cDNA Clone; PRUNE cdna clone
Ordering
For Research Use Only!
Sequence
atgctgagaaaagaccagaagactatctatagacaaggcgtcaaggtggccattagtgcaatatatatggatttggagatctgtgaagtcctggaacgctcccactctccacccctgaagctgacccctgcctcaagtacccaccctaacctccatgcctatcttcaaggcaacacccaggtctctcgaaagaaacttctgcccctgctccaggaagccctgtcagcatattttgactccatgaagatcccttcaggacagcctgagacagcagatgtgtccagggagcaagtggacaaggaattggacagggcaagtaactccctgatttctggactgagtcaagatgaggaggaccctccgctgcccccgacgcccatgaacagcttggtggatgagtgccctctagatcaggggctgcctaaactctctgctgaggccgtcttcgagaagtgcagtcagatctcactgtcacagtctaccacagcctccctgtccaagaagtga
Sequence Length
507
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,475 Da
NCBI Official Full Name
Homo sapiens prune homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
prune exopolyphosphatase
NCBI Official Symbol
PRUNE1
NCBI Official Synonym Symbols
PRUNE; DRES17; HTCD37; DRES-17; H-PRUNE
NCBI Protein Information
protein prune homolog
UniProt Protein Name
Protein prune homolog
Protein Family
UniProt Gene Name
PRUNE
UniProt Synonym Gene Names
hPrune; DRES-17; DRES17
UniProt Entry Name
PRUNE_HUMAN

NCBI Description

This gene encodes a member of the DHH protein superfamily of phosphoesterases. This protein has been found to function as both a nucleotide phosphodiesterase and an exopolyphosphatase. This protein is believed to stimulate cancer progression and metastases through the induction of cell motility. A pseuodgene has been identified on chromosome 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Uniprot Description

PRUNE: Phosphodiesterase (PDE) that has higher activity toward cAMP than cGMP, as substrate. Plays a role in cell proliferation, is able to induce cell motility and acts as a negative regulator of NME1. Belongs to the PPase class C family. Prune subfamily. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleotide Metabolism - purine; EC 3.6.1.1; Hydrolase

Chromosomal Location of Human Ortholog: 1q21

Cellular Component: cytoplasm

Molecular Function: protein binding

Research Articles on PRUNE

Similar Products

Product Notes

The PRUNE prune (Catalog #AAA1272232) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgagaa aagaccagaa gactatctat agacaaggcg tcaaggtggc cattagtgca atatatatgg atttggagat ctgtgaagtc ctggaacgct cccactctcc acccctgaag ctgacccctg cctcaagtac ccaccctaac ctccatgcct atcttcaagg caacacccag gtctctcgaa agaaacttct gcccctgctc caggaagccc tgtcagcata ttttgactcc atgaagatcc cttcaggaca gcctgagaca gcagatgtgt ccagggagca agtggacaag gaattggaca gggcaagtaa ctccctgatt tctggactga gtcaagatga ggaggaccct ccgctgcccc cgacgcccat gaacagcttg gtggatgagt gccctctaga tcaggggctg cctaaactct ctgctgaggc cgtcttcgag aagtgcagtc agatctcact gtcacagtct accacagcct ccctgtccaa gaagtga. It is sometimes possible for the material contained within the vial of "PRUNE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.