Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRTFDC1 cdna clone

PRTFDC1 cDNA Clone

Gene Names
PRTFDC1; HHGP
Synonyms
PRTFDC1; PRTFDC1 cDNA Clone; PRTFDC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgggagcagcgaggaggcgccagactacgggcgaggcgtcgtgattatggatgattggccagggtatgacttgaatttattcacgtacccacagcactattatggagacttggagtatgtcctcatccctcatggtatcattgtggacagaattgagcggctggccaaggatattatgaaagacataggatatagtgacatcatggtcctgtgtgtgcttaaaggaggttacaaattctgtgctgatctcgtagaacaccttaagaacatcagccgaaattcagatcgatttgtctcaatgaaggttgatttcatcagactaaaaagttacaggaatgaccagtccatgggtgagatgcagataatcggaggcgatgatctttcaacgctggctggaaagaatgttctcattgttgaggatgttgtcggaactgggaggaccatgaaagcactactcagcaatatagagaaatacaagcccaacatgattaaggtagccagtttgttggtgaagagaacatccagaagtgacggctttagacctgactatgctggatttgagattccaaacttatttgtggtgggatatgccttagattacaatgaatacttcagagatctgaatcacatatgcgtcatcaatgagcacggtaaagaaaaatatcgagtctaa
Sequence Length
678
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,983 Da
NCBI Official Full Name
Homo sapiens phosphoribosyl transferase domain containing 1, mRNA
NCBI Official Synonym Full Names
phosphoribosyl transferase domain containing 1
NCBI Official Symbol
PRTFDC1
NCBI Official Synonym Symbols
HHGP
NCBI Protein Information
phosphoribosyltransferase domain-containing protein 1
UniProt Protein Name
Phosphoribosyltransferase domain-containing protein 1
UniProt Gene Name
PRTFDC1
UniProt Synonym Gene Names
HHGP
UniProt Entry Name
PRDC1_HUMAN

Uniprot Description

PRTFDC1: Has low, barely detectable phosphoribosyltransferase activity (in vitro). Binds GMP, IMP and alpha-D-5-phosphoribosyl 1-pyrophosphate (PRPP). Is not expected to contribute to purine metabolism or GMP salvage. Belongs to the purine/pyrimidine phosphoribosyltransferase family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 10p12.1

Cellular Component: cytosol

Molecular Function: hypoxanthine phosphoribosyltransferase activity; magnesium ion binding; protein binding; protein homodimerization activity

Biological Process: adenine salvage; GMP catabolic process; GMP salvage; guanine salvage; hypoxanthine metabolic process; IMP salvage

Research Articles on PRTFDC1

Similar Products

Product Notes

The PRTFDC1 prtfdc1 (Catalog #AAA1272806) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccggga gcagcgagga ggcgccagac tacgggcgag gcgtcgtgat tatggatgat tggccagggt atgacttgaa tttattcacg tacccacagc actattatgg agacttggag tatgtcctca tccctcatgg tatcattgtg gacagaattg agcggctggc caaggatatt atgaaagaca taggatatag tgacatcatg gtcctgtgtg tgcttaaagg aggttacaaa ttctgtgctg atctcgtaga acaccttaag aacatcagcc gaaattcaga tcgatttgtc tcaatgaagg ttgatttcat cagactaaaa agttacagga atgaccagtc catgggtgag atgcagataa tcggaggcga tgatctttca acgctggctg gaaagaatgt tctcattgtt gaggatgttg tcggaactgg gaggaccatg aaagcactac tcagcaatat agagaaatac aagcccaaca tgattaaggt agccagtttg ttggtgaaga gaacatccag aagtgacggc tttagacctg actatgctgg atttgagatt ccaaacttat ttgtggtggg atatgcctta gattacaatg aatacttcag agatctgaat cacatatgcg tcatcaatga gcacggtaaa gaaaaatatc gagtctaa. It is sometimes possible for the material contained within the vial of "PRTFDC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.