PRSS23 cdna clone

PRSS23 cDNA Clone

Gene Names

PRSS23; SIG13; SPUVE; ZSIG13

Synonyms

PRSS23; PRSS23 cDNA Clone; PRSS23 cdna clone

Ordering
Cat. Num. AAA1269502 For Research Use Only!

Sequence

atggcagggattccagggctcctcttccttctcttctttctgctctgtgctgttgggcaagtgagcccttacagtgccccctggaaacccacttggcctgcataccgcctccctgtcgtcttgccccagtctaccctcaatttagccaagccagactttggagccgaagccaaattagaagtatcttcttcatgtggaccccagtgtcataagggaactccactgcccacttacgaagaggccaagcaatatctgtcttatgaaacgctctatgccaatggcagccgcacagagacgcaggtgggcatctacatcctcagcagtagtggagatggggcccaacaccgagactcagggtcttcaggaaagtctcgaaggaagcggcagatttatggctatgacagcaggttcagcatttttgggaaggacttcctgctcaactaccctttctcaacatcagtgaagttatccacgggctgcaccggcaccctggtggcagagaagcatgtcctcacagctgcccactgcatacacgatggaaaaacctatgtgaaaggaacccagaagcttcgagtgggcttcctaaagcccaagtttaaagatggtggtcgaggggccaacgactccacttcagccatgcccgagcagatgaaatttcagtggatccgggtgaaacgcacccatgtgcccaagggttggatcaagggcaatgccaatgacatcggcatggattatgattatgccctcctggaactcaaaaagccccacaagagaaaatttatgaagattggggtgagccctcctgctaagcagctgccagggggcagaattcacttctctggttatgacaatgaccgaccaggcaatttggtgtatcgcttctgtgacgtcaaagacgagacctatgacttgctctaccagcaatgcgatgcccagccaggggccagcgggtctggggtctatgtgaggatgtggaagagacagcagcagaagtgggagcgaaaaattattggcattttttcagggcaccagtgggtggacatgaatggttccccacaggatttcaacgtggctgtcagaatcactcctctcaaatatgcccagatttgctattggattaaaggaaactacctggattgtagggaggggtga

Sequence Length

1152

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

12654868

NCBI GeneID

11098

Molecular Weight

39,642 Da

NCBI Official Full Name

Homo sapiens protease, serine, 23, mRNA

NCBI Official Synonym Full Names

protease, serine 23

NCBI Official Symbol

PRSS23

NCBI Official Synonym Symbols

SIG13; SPUVE; ZSIG13

NCBI Protein Information

serine protease 23

UniProt Protein Name

Serine protease 23

Protein Family

Serine protease

UniProt Gene Name

PRSS23

UniProt Synonym Gene Names

ZSIG13

UniProt Entry Name

PRS23_HUMAN

NCBI Description

This gene encodes a conserved member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels of this gene after ovulation was induced. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

Uniprot Description

PRSS23: a member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels after ovulation was induced. This gene seems to be highly conserved in vertebrates and may be an important ovarian protease. [provided by RefSeq, Jul 2008]

Protein type: Secreted; EC 3.4.21.-; Secreted, signal peptide; Protease

Chromosomal Location of Human Ortholog: 11q14.1

Cellular Component: nucleus

Research Articles on PRSS23

1. PRSS23 might be a critical component of estrogen-mediated cell proliferation of ERalpha-positive breast cancer cells.

Similar Products

Product Notes

The PRSS23 prss23 (Catalog #AAA1269502) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggga ttccagggct cctcttcctt ctcttctttc tgctctgtgc tgttgggcaa gtgagccctt acagtgcccc ctggaaaccc acttggcctg cataccgcct ccctgtcgtc ttgccccagt ctaccctcaa tttagccaag ccagactttg gagccgaagc caaattagaa gtatcttctt catgtggacc ccagtgtcat aagggaactc cactgcccac ttacgaagag gccaagcaat atctgtctta tgaaacgctc tatgccaatg gcagccgcac agagacgcag gtgggcatct acatcctcag cagtagtgga gatggggccc aacaccgaga ctcagggtct tcaggaaagt ctcgaaggaa gcggcagatt tatggctatg acagcaggtt cagcattttt gggaaggact tcctgctcaa ctaccctttc tcaacatcag tgaagttatc cacgggctgc accggcaccc tggtggcaga gaagcatgtc ctcacagctg cccactgcat acacgatgga aaaacctatg tgaaaggaac ccagaagctt cgagtgggct tcctaaagcc caagtttaaa gatggtggtc gaggggccaa cgactccact tcagccatgc ccgagcagat gaaatttcag tggatccggg tgaaacgcac ccatgtgccc aagggttgga tcaagggcaa tgccaatgac atcggcatgg attatgatta tgccctcctg gaactcaaaa agccccacaa gagaaaattt atgaagattg gggtgagccc tcctgctaag cagctgccag ggggcagaat tcacttctct ggttatgaca atgaccgacc aggcaatttg gtgtatcgct tctgtgacgt caaagacgag acctatgact tgctctacca gcaatgcgat gcccagccag gggccagcgg gtctggggtc tatgtgagga tgtggaagag acagcagcag aagtgggagc gaaaaattat tggcattttt tcagggcacc agtgggtgga catgaatggt tccccacagg atttcaacgt ggctgtcaga atcactcctc tcaaatatgc ccagatttgc tattggatta aaggaaacta cctggattgt agggaggggt ga. It is sometimes possible for the material contained within the vial of "PRSS23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

PRSS23 cdna clone