PRPF40A cdna clone
PRPF40A cDNA Clone
Gene Names
PRPF40A; HYPA; FBP11; FLAF1; FNBP3; HIP10; Prp40; FBP-11; HIP-10; NY-REN-6
Synonyms
PRPF40A; PRPF40A cDNA Clone; PRPF40A cdna clone
Sequence
atgaaacgaaaagaatctgcatttaagagtatgttaaaacaagctgctcctccgatagaattggatgctgtctgggaagatatccgtgagagatttgtaaaagagccagcatttgaggacataactctagaatctgaaagaaaacgaatatttaaagattttatgcatgtgcttgagcatgaatgtcagcatcatcattcaaagaacaagaaacattctaagaaatctaaaaaacatcataggaaacgttcccgctctcgatcggggtcagattcagatgatgatgatagccattcaaagaaaaaaagacagcgatcagagtctcgttctgcttcagaacattcttctagtgcagagtctgagagaagttataaaaagtcaaaaaagcataagaagaaaagtaagaagaggagacataaatctgactctccagaatccgatgctgagcgagagaaggataaaaaagaaaaagatcgggaaagtgaaaaagacagaactagacaaagatcagaatcaaaacacaaatcgcctaagaaaaagactggaaaggattctggtaattgggatacttctggcagcgaactgagtgaaggggaattggaaaagcgcagaagaacccttttggagcaactggatgatgatcaataa
Sequence Length
648
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
10,697 Da
NCBI Official Full Name
Homo sapiens PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
pre-mRNA processing factor 40 homolog A
NCBI Official Symbol
PRPF40A
NCBI Official Synonym Symbols
HYPA; FBP11; FLAF1; FNBP3; HIP10; Prp40; FBP-11; HIP-10; NY-REN-6
NCBI Protein Information
pre-mRNA-processing factor 40 homolog A
UniProt Protein Name
Pre-mRNA-processing factor 40 homolog A
Protein Family
UniProt Gene Name
PRPF40A
UniProt Synonym Gene Names
FBP11; FLAF1; FNBP3; HIP10; HYPA; HIP-10
UniProt Entry Name
PR40A_HUMAN
Uniprot Description
FNBP3: Binds to WASL/N-WASP and suppresses its translocation from the nucleus to the cytoplasm, thereby inhibiting its cytoplasmic function. Plays a role in the regulation of cell morphology and cytoskeletal organization. Required in the control of cell shape and migration. May play a role in cytokinesis. May be involved in pre-mRNA splicing. Belongs to the PRPF40 family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: RNA processing; Spliceosome
Chromosomal Location of Human Ortholog: 2q23.3
Cellular Component: cytoplasm; membrane; nuclear matrix; nucleoplasm; snRNP U1
Molecular Function: protein binding; RNA binding
Biological Process: cell migration; cytoskeleton organization and biogenesis; nuclear mRNA splicing, via spliceosome; regulation of cell shape; regulation of cytokinesis
Research Articles on PRPF40A
Similar Products
Product Notes
The PRPF40A prpf40a (Catalog #AAA1267804) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaacgaa aagaatctgc atttaagagt atgttaaaac aagctgctcc tccgatagaa ttggatgctg tctgggaaga tatccgtgag agatttgtaa aagagccagc atttgaggac ataactctag aatctgaaag aaaacgaata tttaaagatt ttatgcatgt gcttgagcat gaatgtcagc atcatcattc aaagaacaag aaacattcta agaaatctaa aaaacatcat aggaaacgtt cccgctctcg atcggggtca gattcagatg atgatgatag ccattcaaag aaaaaaagac agcgatcaga gtctcgttct gcttcagaac attcttctag tgcagagtct gagagaagtt ataaaaagtc aaaaaagcat aagaagaaaa gtaagaagag gagacataaa tctgactctc cagaatccga tgctgagcga gagaaggata aaaaagaaaa agatcgggaa agtgaaaaag acagaactag acaaagatca gaatcaaaac acaaatcgcc taagaaaaag actggaaagg attctggtaa ttgggatact tctggcagcg aactgagtga aggggaattg gaaaagcgca gaagaaccct tttggagcaa ctggatgatg atcaataa. It is sometimes possible for the material contained within the vial of "PRPF40A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
