Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRPF4 cdna clone

PRPF4 cDNA Clone

Gene Names
PRPF4; PRP4; RP70; HPRP4; Prp4p; HPRP4P; SNRNP60
Synonyms
PRPF4; PRPF4 cDNA Clone; PRPF4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcctcgcgagcctcttccacggcaaccaaaactaaagcacccgacgacttagttgctccggtcgtgaagaaaccacacatctattatggaagtttggaagagaaggagagggagcgtctggccaaaggagagtctgggattttggggaaagacggacttaaagcagggatcgaagctggaaatattaatataacctctggagaagtgtttgaaattgaagagcatatcagcgagcgacaggcagaagtattggctgagtttgagagaaggaagcgagcccggcagatcaatgtttccacagatgactcagaggtcaaagcttgccttagagccttgggggaacccatcacactttttggagagggtcctgctgaaagaagagaaaggttaagaaatatcctctcagttgtcggtactgatgccttgaaaaagaccaaaaaggatgatgagaagtctaaaaagtccaaagaagagtatcagcaaacctggtatcatgaaggaccaaatagcttgaaggtggcaagactatggattgctaattattcgttgcccagggcaatgaaacgcttggaagaggcccgactccataaggagattcctgagacaacaaggacctcccagatgcaagagctgcacaagtctctccggtctttgaataatttttgcagtcagattggggatgatcggcctatctcctactgtcactttagtcccaattccaagatgctggccacagcttgttggagtgggctttgcaagctctggtctgttcctgattgcaacctccttcacactcttcgagggcataacacaaatgtaggagcaattgtattccatcccaaatccactgtctccttggacccaaaagatgtcaacctggcctcttgtgcggctgatggctctgtgaagctttggagtctcgacagtgatgaaccagtggcagatattgaaggccatacagtgcgtgtggcgcgggtaatgtggcatccttcaggacgtttcctgggcaccacctgctatgaccgttcatggcgcttatgggatttggaggctcaagaggagatcctgcatcaggaaggccatagcatgggtgtgtatgacattgccttccatcaagatggctctttggctggcactgggggactggatgcatttggtcgagtttgggacctacgcacaggacgttgtatcatgttcttagaaggccacctgaaagaaatctatggaataaatttctcccccaatggctatcacattgcaaccggcagtggtgacaacacctgcaaagtgtgggacctccgacagcggcgttgcgtctacaccatccctgctcatcagaacttagtgactggtgtcaagtttgagcctatccatgggaacttcttgcttactggtgcctatgataacacagccaagatctggacgcacccaggctggtccccgctgaagactctggctggccacgaaggcaaagtgatgggcctagatatttcttccgatgggcagctcatagccacttgctcatatgacaggaccttcaagctgtggatggctgaatag
Sequence Length
1566
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,321 Da
NCBI Official Full Name
Homo sapiens PRP4 pre-mRNA processing factor 4 homolog (yeast), mRNA
NCBI Official Synonym Full Names
pre-mRNA processing factor 4
NCBI Official Symbol
PRPF4
NCBI Official Synonym Symbols
PRP4; RP70; HPRP4; Prp4p; HPRP4P; SNRNP60
NCBI Protein Information
U4/U6 small nuclear ribonucleoprotein Prp4
UniProt Protein Name
U4/U6 small nuclear ribonucleoprotein Prp4
UniProt Gene Name
PRPF4
UniProt Synonym Gene Names
PRP4; hPrp4
UniProt Entry Name
PRP4_HUMAN

NCBI Description

The protein encoded by this gene is part of a heteromeric complex that binds U4, U5, and U6 small nuclear RNAs and is involved in pre-mRNA splicing. The encoded protein also is a mitotic checkpoint protein and a regulator of chemoresistance in human ovarian cancer. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]

Uniprot Description

PRPF4: Involved in pre-mRNA splicing. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA splicing; RNA processing; Spliceosome

Chromosomal Location of Human Ortholog: 9q31-q33

Cellular Component: Cajal body; nuclear speck; nucleoplasm; nucleus; spliceosome; U4/U6 x U5 tri-snRNP complex

Molecular Function: protein binding; U4 snRNA binding; U6 snRNA binding

Biological Process: nuclear mRNA splicing, via spliceosome; RNA processing; RNA splicing

Disease: Retinitis Pigmentosa 70

Research Articles on PRPF4

Similar Products

Product Notes

The PRPF4 prpf4 (Catalog #AAA1277032) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcct cgcgagcctc ttccacggca accaaaacta aagcacccga cgacttagtt gctccggtcg tgaagaaacc acacatctat tatggaagtt tggaagagaa ggagagggag cgtctggcca aaggagagtc tgggattttg gggaaagacg gacttaaagc agggatcgaa gctggaaata ttaatataac ctctggagaa gtgtttgaaa ttgaagagca tatcagcgag cgacaggcag aagtattggc tgagtttgag agaaggaagc gagcccggca gatcaatgtt tccacagatg actcagaggt caaagcttgc cttagagcct tgggggaacc catcacactt tttggagagg gtcctgctga aagaagagaa aggttaagaa atatcctctc agttgtcggt actgatgcct tgaaaaagac caaaaaggat gatgagaagt ctaaaaagtc caaagaagag tatcagcaaa cctggtatca tgaaggacca aatagcttga aggtggcaag actatggatt gctaattatt cgttgcccag ggcaatgaaa cgcttggaag aggcccgact ccataaggag attcctgaga caacaaggac ctcccagatg caagagctgc acaagtctct ccggtctttg aataattttt gcagtcagat tggggatgat cggcctatct cctactgtca ctttagtccc aattccaaga tgctggccac agcttgttgg agtgggcttt gcaagctctg gtctgttcct gattgcaacc tccttcacac tcttcgaggg cataacacaa atgtaggagc aattgtattc catcccaaat ccactgtctc cttggaccca aaagatgtca acctggcctc ttgtgcggct gatggctctg tgaagctttg gagtctcgac agtgatgaac cagtggcaga tattgaaggc catacagtgc gtgtggcgcg ggtaatgtgg catccttcag gacgtttcct gggcaccacc tgctatgacc gttcatggcg cttatgggat ttggaggctc aagaggagat cctgcatcag gaaggccata gcatgggtgt gtatgacatt gccttccatc aagatggctc tttggctggc actgggggac tggatgcatt tggtcgagtt tgggacctac gcacaggacg ttgtatcatg ttcttagaag gccacctgaa agaaatctat ggaataaatt tctcccccaa tggctatcac attgcaaccg gcagtggtga caacacctgc aaagtgtggg acctccgaca gcggcgttgc gtctacacca tccctgctca tcagaactta gtgactggtg tcaagtttga gcctatccat gggaacttct tgcttactgg tgcctatgat aacacagcca agatctggac gcacccaggc tggtccccgc tgaagactct ggctggccac gaaggcaaag tgatgggcct agatatttct tccgatgggc agctcatagc cacttgctca tatgacagga ccttcaagct gtggatggct gaatag. It is sometimes possible for the material contained within the vial of "PRPF4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.