Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRPF38B cdna clone

PRPF38B cDNA Clone

Gene Names
PRPF38B; NET1
Synonyms
PRPF38B; PRPF38B cDNA Clone; PRPF38B cdna clone
Ordering
For Research Use Only!
Sequence
atggctaacaacagccccgcgctgacaggcaactcgcagccgcagcaccaggcggctgcagctgcggctcagcaacagcagcagtgcggcggcggcggcgctaccaagccggcggtctccggcaagcagggcaatgtgctcccgctctggggcaacgagaagaccatgaacctcaaccccatgatcctgaccaacatcctgtcgtcgccttacttcaaagtacagctctacgagctcaagacctaccacgaggtggtggacgagatctactttaaggtcacgcacgttgaaccatgggagaaaggaagcaggaaaacagcgggccagacagggatgtgcggaggggttcgaggtgttggaacaggaggaattgtttctacagcattttgcctgttatacaaattatttaccctgaagttaactcgaaagcaagtgatgggtcttataacacacacagactctccatatattagagcgcttggatttatgtatataagatatacacagccccctacagatctgtgggactggtttgaatccttccttgatgatgaagagttcttcaccctctag
Sequence Length
573
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,061 Da
NCBI Official Full Name
Homo sapiens PRP38 pre-mRNA processing factor 38 (yeast) domain containing B, mRNA
NCBI Official Synonym Full Names
pre-mRNA processing factor 38B
NCBI Official Symbol
PRPF38B
NCBI Official Synonym Symbols
NET1
NCBI Protein Information
pre-mRNA-splicing factor 38B
UniProt Protein Name
Pre-mRNA-splicing factor 38B
Protein Family
UniProt Gene Name
PRPF38B
UniProt Entry Name
PR38B_HUMAN

Uniprot Description

PRPF38B: may have pre-mRNA splicing activity. Two alternatively spliced human isoforms have been described.

Protein type: RNA splicing; RNA processing

Chromosomal Location of Human Ortholog: 1p13.3

Similar Products

Product Notes

The PRPF38B prpf38b (Catalog #AAA1270304) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaaca acagccccgc gctgacaggc aactcgcagc cgcagcacca ggcggctgca gctgcggctc agcaacagca gcagtgcggc ggcggcggcg ctaccaagcc ggcggtctcc ggcaagcagg gcaatgtgct cccgctctgg ggcaacgaga agaccatgaa cctcaacccc atgatcctga ccaacatcct gtcgtcgcct tacttcaaag tacagctcta cgagctcaag acctaccacg aggtggtgga cgagatctac tttaaggtca cgcacgttga accatgggag aaaggaagca ggaaaacagc gggccagaca gggatgtgcg gaggggttcg aggtgttgga acaggaggaa ttgtttctac agcattttgc ctgttataca aattatttac cctgaagtta actcgaaagc aagtgatggg tcttataaca cacacagact ctccatatat tagagcgctt ggatttatgt atataagata tacacagccc cctacagatc tgtgggactg gtttgaatcc ttccttgatg atgaagagtt cttcaccctc tag. It is sometimes possible for the material contained within the vial of "PRPF38B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.