Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRPF31 cdna clone

PRPF31 cDNA Clone

Gene Names
PRPF31; RP11; PRP31; SNRNP61; NY-BR-99
Synonyms
PRPF31; PRPF31 cDNA Clone; PRPF31 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctctggcagatgagctcttagctgatctcgaagaggcagcagaagaggaggaaggaggaagctatggggaggaagaagaggagccagcgatcgaggatgtgcaggaggagacacagctggatctttccggggattcagtcaagaccatcgccaagctatgggatagtaagatgtttgctgagattatgatgaagattgaggagtatatcagcaagcaagccaaagcttcagaagtgatgggaccagtggaggccgcgcctgaataccgcgtcatcgtggatgccaacaacctgaccgtggagatcgaaaacgagctgaacatcatccataagttcatccgggataagtactcaaagagattccctgaactggagtccttggtccccaatgcactggattacatccgcacggtcaaggagctgggcaacagcctggacaagtgcaagaacaatgagaacctgcagcagatcctcaccaatgccaccatcatggtcgtcagcgtcaccgcctccaccacccaggggcagcagctgtcggaggaggagctggagcggctggaggaggcctgcgacatggcgctggagctgaacgcctccaagcaccgcatctacgagtatgtggagtcccggatgtccttcatcgcacccaacctgtccatcattatcggggcatccacggccgccaagatcatgggtgtggccggcggcctgaccaacctctccaagatgcccgcctgcaacatcatgctgctcggggcccagcgcaagacgctgtcgggcttctcgtctacctcagtgctgccccacaccggctacatctaccacagtgacatcgtgcagtccctgccaccggatctgcggcggaaagcggcccggctggtggccgccaagtgcacactggcagcccgtgtggacagtttccacgagagcacagaagggaaggtgggctacgaactgaaggatgagatcgagcgcaaattcgacaagtggcaggagccgccgcctgtgaagcaggtgaagccgctgcctgcgcccctggatggacagcggaagaagcgaggcggccgcaggtaccgcaagatgaaggagcggctggggctgacggagatccggaagcaggccaaccgtatgagcttcggagagatcgaggaggacgcctaccaggaggacctgggattcagcctgggccacctgggcaagtcgggcagtgggcgtgtgcggcagacacaggtaaacgaggccaccaaggccaggatctccaagacgctgcagcggaccctgcagaagcagagcgtcgtatatggcgggaagtccaccatccgcgaccgctcctcgggcacggcctccagcgtggccttcaccccactccagggcctggagattgtgaacccacaggcggcagagaagaaggtggctgaggccaaccagaagtatttctccagcatggctgagttcctcaaggtcaagggcgagaagagtggccttatgtccacctga
Sequence Length
1500
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,909 Da
NCBI Official Full Name
Homo sapiens PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
pre-mRNA processing factor 31
NCBI Official Symbol
PRPF31
NCBI Official Synonym Symbols
RP11; PRP31; SNRNP61; NY-BR-99
NCBI Protein Information
U4/U6 small nuclear ribonucleoprotein Prp31
UniProt Protein Name
U4/U6 small nuclear ribonucleoprotein Prp31
UniProt Gene Name
PRPF31
UniProt Synonym Gene Names
PRP31; Protein 61K; hPrp31
UniProt Entry Name
PRP31_HUMAN

NCBI Description

This gene encodes a component of the spliceosome complex and is one of several retinitis pigmentosa-causing genes. When the gene product is added to the spliceosome complex, activation occurs.[provided by RefSeq, Jan 2009]

Uniprot Description

PRPF31: Involved in pre-mRNA splicing. Required for U4/U6.U5 tri-snRNP formation. Defects in PRPF31 are the cause of retinitis pigmentosa type 11 (RP11). RP leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. RP11 inheritance is autosomal dominant. Belongs to the PRP31 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA splicing; RNA-binding; Spliceosome

Chromosomal Location of Human Ortholog: 19q13.42

Cellular Component: Cajal body; nuclear speck; nucleoplasm; nucleus; U4/U6 x U5 tri-snRNP complex

Molecular Function: protein binding; ribonucleoprotein binding; U4 snRNA binding; U4atac snRNA binding

Biological Process: assembly of spliceosomal tri-snRNP; nuclear mRNA splicing, via spliceosome; snoRNA localization

Disease: Retinitis Pigmentosa 11

Research Articles on PRPF31

Similar Products

Product Notes

The PRPF31 prpf31 (Catalog #AAA1265780) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctctgg cagatgagct cttagctgat ctcgaagagg cagcagaaga ggaggaagga ggaagctatg gggaggaaga agaggagcca gcgatcgagg atgtgcagga ggagacacag ctggatcttt ccggggattc agtcaagacc atcgccaagc tatgggatag taagatgttt gctgagatta tgatgaagat tgaggagtat atcagcaagc aagccaaagc ttcagaagtg atgggaccag tggaggccgc gcctgaatac cgcgtcatcg tggatgccaa caacctgacc gtggagatcg aaaacgagct gaacatcatc cataagttca tccgggataa gtactcaaag agattccctg aactggagtc cttggtcccc aatgcactgg attacatccg cacggtcaag gagctgggca acagcctgga caagtgcaag aacaatgaga acctgcagca gatcctcacc aatgccacca tcatggtcgt cagcgtcacc gcctccacca cccaggggca gcagctgtcg gaggaggagc tggagcggct ggaggaggcc tgcgacatgg cgctggagct gaacgcctcc aagcaccgca tctacgagta tgtggagtcc cggatgtcct tcatcgcacc caacctgtcc atcattatcg gggcatccac ggccgccaag atcatgggtg tggccggcgg cctgaccaac ctctccaaga tgcccgcctg caacatcatg ctgctcgggg cccagcgcaa gacgctgtcg ggcttctcgt ctacctcagt gctgccccac accggctaca tctaccacag tgacatcgtg cagtccctgc caccggatct gcggcggaaa gcggcccggc tggtggccgc caagtgcaca ctggcagccc gtgtggacag tttccacgag agcacagaag ggaaggtggg ctacgaactg aaggatgaga tcgagcgcaa attcgacaag tggcaggagc cgccgcctgt gaagcaggtg aagccgctgc ctgcgcccct ggatggacag cggaagaagc gaggcggccg caggtaccgc aagatgaagg agcggctggg gctgacggag atccggaagc aggccaaccg tatgagcttc ggagagatcg aggaggacgc ctaccaggag gacctgggat tcagcctggg ccacctgggc aagtcgggca gtgggcgtgt gcggcagaca caggtaaacg aggccaccaa ggccaggatc tccaagacgc tgcagcggac cctgcagaag cagagcgtcg tatatggcgg gaagtccacc atccgcgacc gctcctcggg cacggcctcc agcgtggcct tcaccccact ccagggcctg gagattgtga acccacaggc ggcagagaag aaggtggctg aggccaacca gaagtatttc tccagcatgg ctgagttcct caaggtcaag ggcgagaaga gtggccttat gtccacctga. It is sometimes possible for the material contained within the vial of "PRPF31, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.