Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRPF19 cdna clone

PRPF19 cDNA Clone

Gene Names
PRPF19; PSO4; SNEV; PRP19; UBOX4; hPSO4; NMP200
Synonyms
PRPF19; PRPF19 cDNA Clone; PRPF19 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccctaatctgctccatctctaacgaagtgccggagcacccatgtgtatcccctgtctctaatcatgtttatgagcggcggctcatcgagaagtacattgcggagaatggtaccgaccccatcaacaaccagcctctctccgaggagcagctcatcgacatcaaagttgctcacccaatccggcccaagcctccctcagccaccagcatcccggccattctgaaagctttgcaggatgagtgggatgcagtcatgctgcacagcttcactctgcgccagcagctgcagacaacccgccaagagctgtcacacgctctgtaccagcacgatgccgcctgccgtgtcattgcccgtctcaccaaggaagtcactgctgcccgagaagctctggctaccctgaaaccacaggctggcctcattgtgccccaggctgtgccaagttcccaaccaagtgttgtgggtgcgggtgagccaatggatttgggtgagctggtgggaatgaccccagagattattcagaagcttcaagacaaagccactgtgctaaccacggagcgcaagaagagagggaagactgtgcctgaggagctggtgaagccagaagagctcagcaaataccggcaggtggcatcccacgtggggttgcacagtgccagcattcctgggatcctggccctggacctctgcccgtccgacaccaacaagatcctcactggtggggcggataaaaatgtcgttgtgtttgacaaaagttctgaacaaatcctggctaccctcaaaggccataccaagaaggtcaccagcgtggtgtttcacccttcccaggacctggtgttttctgcttcccccgatgccactatcaggatttggtcggtccccaatgcctcttgtgtacaggtggttcgggcccatgagagtgctgtgacaggcctcagccttcatgccactggcgactatctcctgagctcctccgatgatcagtactgggctttctctgacatccagacagggcgtgtgctcaccaaggtgacagatgagacctccggctgctctctcacctgtgcacagttccaccctgacggactcatctttggaacaggaaccatggactctcagatcaagatctgggacttgaaggaacgtactaatgtggccaacttccctggccactcgggccccatcactagcatcgccttctctgagaatggttactacctggctacagcggctgatgactcctctgtcaagctctgggatctgcgcaagcttaagaactttaagactttgcagctggataacaactttgaggtaaagtcactgatctttgaccagagtggtacctacctggctcttgggggcacggatgtccagatctacatctgcaaacaatggacggagattcttcactttacagagcatagcggcctgaccacaggggtggccttcgggcatcacgccaagttcatcgcttcaacaggcatggacagaagcctcaagttctacagcctgtag
Sequence Length
1515
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,181 Da
NCBI Official Full Name
Homo sapiens PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
pre-mRNA processing factor 19
NCBI Official Symbol
PRPF19
NCBI Official Synonym Symbols
PSO4; SNEV; PRP19; UBOX4; hPSO4; NMP200
NCBI Protein Information
pre-mRNA-processing factor 19
UniProt Protein Name
Pre-mRNA-processing factor 19
UniProt Gene Name
PRPF19
UniProt Synonym Gene Names
hPso4
UniProt Entry Name
PRP19_HUMAN

NCBI Description

PSO4 is the human homolog of yeast Pso4, a gene essential for cell survival and DNA repair (Beck et al., 2008 [PubMed 18263876]).[supplied by OMIM, Sep 2008]

Uniprot Description

PRPF19: Plays a role in DNA double-strand break (DSB) repair. Binds double-stranded DNA in a sequence-nonspecific manner. Acts as a structural component of the nuclear framework. May also serve as a support for spliceosome binding and activity. Essential for spliceosome assembly in a oligomerization-dependent manner and might also be important for spliceosome stability. May have E3 ubiquitin ligase activity. The PSO4 complex is required in the DNA interstrand cross-links (ICLs) repair process. Component of the PRP19-CDC5L complex that forms an integral part of the spliceosome and is required for activating pre-mRNA splicing. Belongs to the WD repeat PRP19 family.

Protein type: Ubiquitin conjugating system; RNA splicing; Spliceosome; Ubiquitin ligase; Ligase; EC 6.3.2.19; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 11q12.2

Cellular Component: cytoplasm; DNA replication factor A complex; membrane; nuclear speck; nucleoplasm; nucleus

Molecular Function: identical protein binding; protein binding

Biological Process: assembly of spliceosomal tri-snRNP; double-strand break repair via nonhomologous end joining; nuclear mRNA splicing, via spliceosome; proteasomal protein catabolic process; protein polyubiquitination; spliceosome assembly; transcription-coupled nucleotide-excision repair

Research Articles on PRPF19

Similar Products

Product Notes

The PRPF19 prpf19 (Catalog #AAA1265652) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccctaa tctgctccat ctctaacgaa gtgccggagc acccatgtgt atcccctgtc tctaatcatg tttatgagcg gcggctcatc gagaagtaca ttgcggagaa tggtaccgac cccatcaaca accagcctct ctccgaggag cagctcatcg acatcaaagt tgctcaccca atccggccca agcctccctc agccaccagc atcccggcca ttctgaaagc tttgcaggat gagtgggatg cagtcatgct gcacagcttc actctgcgcc agcagctgca gacaacccgc caagagctgt cacacgctct gtaccagcac gatgccgcct gccgtgtcat tgcccgtctc accaaggaag tcactgctgc ccgagaagct ctggctaccc tgaaaccaca ggctggcctc attgtgcccc aggctgtgcc aagttcccaa ccaagtgttg tgggtgcggg tgagccaatg gatttgggtg agctggtggg aatgacccca gagattattc agaagcttca agacaaagcc actgtgctaa ccacggagcg caagaagaga gggaagactg tgcctgagga gctggtgaag ccagaagagc tcagcaaata ccggcaggtg gcatcccacg tggggttgca cagtgccagc attcctggga tcctggccct ggacctctgc ccgtccgaca ccaacaagat cctcactggt ggggcggata aaaatgtcgt tgtgtttgac aaaagttctg aacaaatcct ggctaccctc aaaggccata ccaagaaggt caccagcgtg gtgtttcacc cttcccagga cctggtgttt tctgcttccc ccgatgccac tatcaggatt tggtcggtcc ccaatgcctc ttgtgtacag gtggttcggg cccatgagag tgctgtgaca ggcctcagcc ttcatgccac tggcgactat ctcctgagct cctccgatga tcagtactgg gctttctctg acatccagac agggcgtgtg ctcaccaagg tgacagatga gacctccggc tgctctctca cctgtgcaca gttccaccct gacggactca tctttggaac aggaaccatg gactctcaga tcaagatctg ggacttgaag gaacgtacta atgtggccaa cttccctggc cactcgggcc ccatcactag catcgccttc tctgagaatg gttactacct ggctacagcg gctgatgact cctctgtcaa gctctgggat ctgcgcaagc ttaagaactt taagactttg cagctggata acaactttga ggtaaagtca ctgatctttg accagagtgg tacctacctg gctcttgggg gcacggatgt ccagatctac atctgcaaac aatggacgga gattcttcac tttacagagc atagcggcct gaccacaggg gtggccttcg ggcatcacgc caagttcatc gcttcaacag gcatggacag aagcctcaag ttctacagcc tgtag. It is sometimes possible for the material contained within the vial of "PRPF19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.