Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PROCR cdna clone

PROCR cDNA Clone

Gene Names
PROCR; CCCA; EPCR; CCD41
Synonyms
PROCR; PROCR cDNA Clone; PROCR cdna clone
Ordering
For Research Use Only!
Sequence
atgttgacaacattgctgccgatactgctgctgtctggctgggccttttgtagccaagacgcctcagatggcctccaaagacttcatatgctccagatctcctacttccgcgacccctatcacgtgtggtaccagggcaacgcgtcgctggggggacacctaacgcacgtgctggaaggcccagacaccaacaccacgatcattcagctgcagcccttgcaggagcccgagagctgggcgcgcacgcagagtggcctgcagtcctacctgctccagttccacggcctcgtgcgcctggtgcaccaggagcggaccttggcctttcctctgaccatccgctgcttcctgggctgtgagctgcctcccgagggctctagagcccatgtcttcttcgaagtggctgtgaatgggagctcctttgtgagtttccggccggagagagccttgtggcaggcagacacccaggtcacctccggagtggtcaccttcaccctgcagcagctcaatgcctacaaccgcactcggtatgaactgcgggaattcctggaggacacctgtgtgcagtatgtgcagaaacatatttccgcggaaaacacgaaagggagccaaacaagccgctcctacacttcgctggtcctgggcgtcctggtgggcggtttcatcattgctggtgtggctgtaggcatcttcctgtgcacaggtggacggcgatgttaa
Sequence Length
717
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,671 Da
NCBI Official Full Name
Homo sapiens protein C receptor, endothelial (EPCR), mRNA
NCBI Official Synonym Full Names
protein C receptor
NCBI Official Symbol
PROCR
NCBI Official Synonym Symbols
CCCA; EPCR; CCD41
NCBI Protein Information
endothelial protein C receptor
UniProt Protein Name
Endothelial protein C receptor
UniProt Gene Name
PROCR
UniProt Synonym Gene Names
EPCR; APC receptor
UniProt Entry Name
EPCR_HUMAN

NCBI Description

The protein encoded by this gene is a receptor for activated protein C, a serine protease activated by and involved in the blood coagulation pathway. The encoded protein is an N-glycosylated type I membrane protein that enhances the activation of protein C. Mutations in this gene have been associated with venous thromboembolism and myocardial infarction, as well as with late fetal loss during pregnancy. The encoded protein may also play a role in malarial infection and has been associated with cancer. [provided by RefSeq, Jul 2013]

Uniprot Description

EPCR: a single-pass type I membrane protein. Binds activated protein C (APC), a serine protease that regulates thrombin (IIa) production. Plays a pivotal role in preventing blood coagulation through binding of activated protein C. Expressed strongly in the endothelial cells of arteries and veins in heart and lung, less intensely in capillaries in the lung and skin, and not at all in the endothelium of small vessels of the liver and kidney. The binding of APC to EPCR and PAR-1 increases invasion and chemotaxis.

Protein type: Receptor, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: 20q11.2

Cellular Component: cell surface; extracellular region; focal adhesion; integral to plasma membrane; plasma membrane

Molecular Function: protein binding; receptor activity

Biological Process: blood coagulation; leukocyte migration; negative regulation of coagulation

Research Articles on PROCR

Similar Products

Product Notes

The PROCR procr (Catalog #AAA1274533) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgacaa cattgctgcc gatactgctg ctgtctggct gggccttttg tagccaagac gcctcagatg gcctccaaag acttcatatg ctccagatct cctacttccg cgacccctat cacgtgtggt accagggcaa cgcgtcgctg gggggacacc taacgcacgt gctggaaggc ccagacacca acaccacgat cattcagctg cagcccttgc aggagcccga gagctgggcg cgcacgcaga gtggcctgca gtcctacctg ctccagttcc acggcctcgt gcgcctggtg caccaggagc ggaccttggc ctttcctctg accatccgct gcttcctggg ctgtgagctg cctcccgagg gctctagagc ccatgtcttc ttcgaagtgg ctgtgaatgg gagctccttt gtgagtttcc ggccggagag agccttgtgg caggcagaca cccaggtcac ctccggagtg gtcaccttca ccctgcagca gctcaatgcc tacaaccgca ctcggtatga actgcgggaa ttcctggagg acacctgtgt gcagtatgtg cagaaacata tttccgcgga aaacacgaaa gggagccaaa caagccgctc ctacacttcg ctggtcctgg gcgtcctggt gggcggtttc atcattgctg gtgtggctgt aggcatcttc ctgtgcacag gtggacggcg atgttaa. It is sometimes possible for the material contained within the vial of "PROCR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.