Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PROC cdna clone

PROC cDNA Clone

Gene Names
PROC; PC; APC; PROC1; THPH3; THPH4
Synonyms
PROC; PROC cDNA Clone; PROC cdna clone
Ordering
For Research Use Only!
Sequence
atgtggcagctcacaagcctcctgctgttcgtggccacctggggaatttccggcacaccagctcctcttgactcagtgttctccagcagcgagcgtgcccaccaggtgctgcggatccgcaaacgtgccaactccttcctggaggagctccgtcacagcagcctggagcgggagtgcatagaggagatctgtgacttcgaggaggccaaggaaattttccaaaatgtggatgacacactggccttctggtccaagcacgtcgacggtgaccagtgcttggtcttgcccttggagcacccgtgcgccagcctgtgctgcgggcacggcacgtgcatcgacggcatcggcagcttcagctgcgactgccgcagcggctgggagggccgcttctgccagcgcgaggtgagcttcctcaattgctctctggacaacggcggctgcacgcattactgcctagaggaggtgggctggcggcgctgtagctgtgcgcctggctacaagctgggggacgacctcctgcagtgtcaccccgcagtgaagttcccttgtgggaggccctggaagcggatggagaagaagcgcagtcacctgaaacgagacacagaagaccaagaagaccaagtagatccgcggctcattgatgggaagatgaccaggcggggagacagcccctggcaggtggtcctgctggactcaaagaagaagctggcctgcggggcagtgctcatccacccctcctgggtgctgacagcggcccactgcatggatgagtccaagaagctccttgtcaggcttggagagtatgacctgcggcgctgggagaagtgggagctggacctggacatcaaggaggtcttcgtccaccccaactacagcaagagcaccaccgacaatgacatcgcactgctgcacctggcccagcccgccaccctctcgcagaccatagtgcccatctgcctcccggacagcggccttgcagagcgcgagctcaatcaggccggccaggagaccctcgtgacgggctggggctaccacagcagccgagagaaggaggccaagagaaaccgcaccttcgtcctcaacttcatcaagattcccgtggtcccgcacaatgagtgcagcgaggtcatgagcaacatggtgtctgagaacatgctgtgtgcgggcatcctcggggaccggcaggatgcctgcgagggcgacagtggggggcccatggtcgcctccttccacggcacctggttcctggtgggcctggtgagctggggtgagggctgtgggctccttcacaactacggcgtttacaccaaagtcagccgctacctcgactggatccatgggcacatcagagacaaggaagccccccagaagagctgggcaccttag
Sequence Length
1386
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,556 Da
NCBI Official Full Name
Homo sapiens protein C (inactivator of coagulation factors Va and VIIIa), mRNA
NCBI Official Synonym Full Names
protein C, inactivator of coagulation factors Va and VIIIa
NCBI Official Symbol
PROC
NCBI Official Synonym Symbols
PC; APC; PROC1; THPH3; THPH4
NCBI Protein Information
vitamin K-dependent protein C
UniProt Protein Name
Vitamin K-dependent protein C
Protein Family
UniProt Gene Name
PROC
UniProt Entry Name
PROC_HUMAN

NCBI Description

This gene encodes a vitamin K-dependent plasma glycoprotein. The encoded protein is cleaved to its activated form by the thrombin-thrombomodulin complex. This activated form contains a serine protease domain and functions in degradation of the activated forms of coagulation factors V and VIII. Mutations in this gene have been associated with thrombophilia due to protein C deficiency, neonatal purpura fulminans, and recurrent venous thrombosis.[provided by RefSeq, Dec 2009]

Uniprot Description

PROC: Protein C is a vitamin K-dependent serine protease that regulates blood coagulation by inactivating factors Va and VIIIa in the presence of calcium ions and phospholipids. Defects in PROC are the cause of thrombophilia due to protein C deficiency, autosomal dominant (THPH3). A hemostatic disorder characterized by impaired regulation of blood coagulation and a tendency to recurrent venous thrombosis. However, many adults with heterozygous disease may be asymptomatic. Individuals with decreased amounts of protein C are classically referred to as having type I protein C deficiency and those with normal amounts of a functionally defective protein as having type II deficiency. Defects in PROC are the cause of thrombophilia due to protein C deficiency, autosomal recessive (THPH4). A hemostatic disorder characterized by impaired regulation of blood coagulation and a tendency to recurrent venous thrombosis. It results in a thrombotic condition that can manifest as a severe neonatal disorder or as a milder disorder with late-onset thrombophilia. The severe form leads to neonatal death through massive neonatal venous thrombosis. Often associated with ecchymotic skin lesions which can turn necrotic called purpura fulminans, this disorder is very rare. Belongs to the peptidase S1 family.

Protein type: EC 3.4.21.69; Apoptosis; Protease

Chromosomal Location of Human Ortholog: 2q13-q14

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen; extracellular region; Golgi apparatus; Golgi lumen

Molecular Function: protein binding; serine-type endopeptidase activity

Biological Process: blood coagulation; ER to Golgi vesicle-mediated transport; leukocyte migration; negative regulation of apoptosis; negative regulation of blood coagulation; negative regulation of coagulation; negative regulation of inflammatory response; peptidyl-glutamic acid carboxylation; signal peptide processing

Disease: Thrombophilia Due To Protein C Deficiency, Autosomal Dominant; Thrombophilia Due To Protein C Deficiency, Autosomal Recessive

Research Articles on PROC

Similar Products

Product Notes

The PROC proc (Catalog #AAA1267610) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggcagc tcacaagcct cctgctgttc gtggccacct ggggaatttc cggcacacca gctcctcttg actcagtgtt ctccagcagc gagcgtgccc accaggtgct gcggatccgc aaacgtgcca actccttcct ggaggagctc cgtcacagca gcctggagcg ggagtgcata gaggagatct gtgacttcga ggaggccaag gaaattttcc aaaatgtgga tgacacactg gccttctggt ccaagcacgt cgacggtgac cagtgcttgg tcttgccctt ggagcacccg tgcgccagcc tgtgctgcgg gcacggcacg tgcatcgacg gcatcggcag cttcagctgc gactgccgca gcggctggga gggccgcttc tgccagcgcg aggtgagctt cctcaattgc tctctggaca acggcggctg cacgcattac tgcctagagg aggtgggctg gcggcgctgt agctgtgcgc ctggctacaa gctgggggac gacctcctgc agtgtcaccc cgcagtgaag ttcccttgtg ggaggccctg gaagcggatg gagaagaagc gcagtcacct gaaacgagac acagaagacc aagaagacca agtagatccg cggctcattg atgggaagat gaccaggcgg ggagacagcc cctggcaggt ggtcctgctg gactcaaaga agaagctggc ctgcggggca gtgctcatcc acccctcctg ggtgctgaca gcggcccact gcatggatga gtccaagaag ctccttgtca ggcttggaga gtatgacctg cggcgctggg agaagtggga gctggacctg gacatcaagg aggtcttcgt ccaccccaac tacagcaaga gcaccaccga caatgacatc gcactgctgc acctggccca gcccgccacc ctctcgcaga ccatagtgcc catctgcctc ccggacagcg gccttgcaga gcgcgagctc aatcaggccg gccaggagac cctcgtgacg ggctggggct accacagcag ccgagagaag gaggccaaga gaaaccgcac cttcgtcctc aacttcatca agattcccgt ggtcccgcac aatgagtgca gcgaggtcat gagcaacatg gtgtctgaga acatgctgtg tgcgggcatc ctcggggacc ggcaggatgc ctgcgagggc gacagtgggg ggcccatggt cgcctccttc cacggcacct ggttcctggt gggcctggtg agctggggtg agggctgtgg gctccttcac aactacggcg tttacaccaa agtcagccgc tacctcgact ggatccatgg gcacatcaga gacaaggaag ccccccagaa gagctgggca ccttag. It is sometimes possible for the material contained within the vial of "PROC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.