Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRKCDBP cdna clone

PRKCDBP cDNA Clone

Gene Names
PRKCDBP; SRBC; HSRBC; CAVIN3; cavin-3
Synonyms
PRKCDBP; PRKCDBP cDNA Clone; PRKCDBP cdna clone
Ordering
For Research Use Only!
Sequence
atgagggagagtgcgttggagccggggcctgtgcccgaggcgccggcggggggtcccgtgcacgccgtgacggtggtgaccctgctggagaagctggcctccatgctggagactctgcgggagcggcagggaggcctggctcgaaggcagggaggcctggcagggtccgtgcgccgcatccagagcggcctgggcgctctgagtcgcagccacgacaccaccagcaacaccttggcgcagctgctggccaaggcggagcgcgtgagctcgcacgccaacgccgcccaagagcgcgcggtgcgccgcgcagcccaggtgcagcggctggaggccaaccacgggctgctggtggcgcgcgggaagctccacgttctgctcttcaaggaggagggtgaagtcccagccagcgctttccagaaggcaccagagcccttgggcccggcggaccagtccgagctgggcccagagcagctggaggccgaagttggagagagctcggacgaggagccggtggagtccagggcccagcggctgcggcgcaccggattgcagaaggtacagagcctccgaagggccctttcgggccggaaaggccctgcagcgccaccgcccaccccggtcaagccgcctcgccttgggcctggccggagcgctgaagcccagccggaagcccagcctgcgctggagcccacgctggagccagagcctccgcaggacaccgaggaagatcccgggagacctggggctgccgaagaagctctgctccaaatggagagtgtagcctga
Sequence Length
786
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,701 Da
NCBI Official Full Name
Homo sapiens protein kinase C, delta binding protein, mRNA
NCBI Official Synonym Full Names
protein kinase C delta binding protein
NCBI Official Symbol
PRKCDBP
NCBI Official Synonym Symbols
SRBC; HSRBC; CAVIN3; cavin-3
NCBI Protein Information
protein kinase C delta-binding protein
UniProt Protein Name
Protein kinase C delta-binding protein
UniProt Gene Name
PRKCDBP
UniProt Synonym Gene Names
SRBC; hSRBC
UniProt Entry Name
PRDBP_HUMAN

NCBI Description

The protein encoded by this gene was identified as a binding protein of the protein kinase C, delta (PRKCD). The expression of this gene in cultured cell lines is strongly induced by serum starvation. The expression of this protein was found to be down-regulated in various cancer cell lines, suggesting the possible tumor suppressor function of this protein. [provided by RefSeq, Jul 2008]

Uniprot Description

PRKCDBP: Seems to have an immune potentiation function. Belongs to the PTRF/SDPR family.

Protein type: Tumor suppressor

Chromosomal Location of Human Ortholog: 11p15.4

Cellular Component: caveola; cytoplasm; protein complex

Molecular Function: protein binding; protein kinase C binding

Biological Process: circadian regulation of gene expression

Research Articles on PRKCDBP

Similar Products

Product Notes

The PRKCDBP prkcdbp (Catalog #AAA1266128) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagggaga gtgcgttgga gccggggcct gtgcccgagg cgccggcggg gggtcccgtg cacgccgtga cggtggtgac cctgctggag aagctggcct ccatgctgga gactctgcgg gagcggcagg gaggcctggc tcgaaggcag ggaggcctgg cagggtccgt gcgccgcatc cagagcggcc tgggcgctct gagtcgcagc cacgacacca ccagcaacac cttggcgcag ctgctggcca aggcggagcg cgtgagctcg cacgccaacg ccgcccaaga gcgcgcggtg cgccgcgcag cccaggtgca gcggctggag gccaaccacg ggctgctggt ggcgcgcggg aagctccacg ttctgctctt caaggaggag ggtgaagtcc cagccagcgc tttccagaag gcaccagagc ccttgggccc ggcggaccag tccgagctgg gcccagagca gctggaggcc gaagttggag agagctcgga cgaggagccg gtggagtcca gggcccagcg gctgcggcgc accggattgc agaaggtaca gagcctccga agggcccttt cgggccggaa aggccctgca gcgccaccgc ccaccccggt caagccgcct cgccttgggc ctggccggag cgctgaagcc cagccggaag cccagcctgc gctggagccc acgctggagc cagagcctcc gcaggacacc gaggaagatc ccgggagacc tggggctgcc gaagaagctc tgctccaaat ggagagtgta gcctga. It is sometimes possible for the material contained within the vial of "PRKCDBP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.