Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRKACG cdna clone

PRKACG cDNA Clone

Gene Names
PRKACG; KAPG; PKACg; BDPLT19
Synonyms
PRKACG; PRKACG cDNA Clone; PRKACG cdna clone
Ordering
For Research Use Only!
Sequence
atgggcaacgcccccgccaagaaggacaccgagcaggaggagagcgtgaacgagttcctagccaaagccagaggagatttcctctacagatggggaaaccccgctcaaaacaccgccagctcggatcagttcgaacggctcaggacgctgggcatgggctccttcgggcgggtgatgctggtgaggcaccaggagaccggcggccactacgccatgaagatcctcaacaagcagaaggtggtgaagatgaagcaggtcgagcacatactgaacgagaagcgcatcctgcaggcgatcgactttccgttcctcgtcaagctccagttctcctttaaggacaactcctacctgtacctggtgatggagtacgtgccgggtggggagatgttctcccgcctacagcgcgtcggaaggtttagcgagccccatgcctgtttctatgccgcccaggtcgtcctggccgtccagtacctacactcgctcgacctcatccaccgcgacctgaagcccgagaatctcctcatcgaccagcagggctacctgcaggtgacggacttcggtttcgccaagcgcgtgaagggccgcacttggaccttgtgcgggaccccagagtacctggcccccgagatcatcctgagcaaaggctacaacaaggccgtggactggtgggccctaggggtgctcatctatgagatggccgtgggcttcccacccttctacgccgaccagcccatccagatctacgagaagatcgtctctgggagggtgcggtttccctccaaactcagctctgacctcaagcatctgctgcggagcctgctgcaggtggacctcaccaagcgcttcggaaacctcaggaacggggttggcgacatcaagaaccacaagtggttcgccacaaccagctggatcgccatctatgagaagaaggtggaagctcccttcatcccgaagtacacaggccctggggatgccagtaactttgacgactacgaggaggaagagctccggatctccatcaatgagaagtgtcccaaggagttttctgagttttag
Sequence Length
1056
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,434 Da
NCBI Official Full Name
Homo sapiens protein kinase, cAMP-dependent, catalytic, gamma, mRNA
NCBI Official Synonym Full Names
protein kinase cAMP-activated catalytic subunit gamma
NCBI Official Symbol
PRKACG
NCBI Official Synonym Symbols
KAPG; PKACg; BDPLT19
NCBI Protein Information
cAMP-dependent protein kinase catalytic subunit gamma
UniProt Protein Name
cAMP-dependent protein kinase catalytic subunit gamma
UniProt Gene Name
PRKACG
UniProt Synonym Gene Names
PKA C-gamma
UniProt Entry Name
KAPCG_HUMAN

NCBI Description

Cyclic AMP-dependent protein kinase (PKA) consists of two catalytic subunits and a regulatory subunit dimer. This gene encodes the gamma form of its catalytic subunit. The gene is intronless and is thought to be a retrotransposon derived from the gene for the alpha form of the PKA catalytic subunit. [provided by RefSeq, Jul 2008]

Uniprot Description

PKACG: Phosphorylates a large number of substrates in the cytoplasm and the nucleus. A number of inactive tetrameric holoenzymes are produced by the combination of homo- or heterodimers of the different regulatory subunits associated with two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Testis specific. But important tissues such as brain and ovary have not been analyzed for the content of transcript. Activated by cAMP. Belongs to the protein kinase superfamily. AGC Ser/Thr protein kinase family. cAMP subfamily.

Protein type: Protein kinase, Ser/Thr (non-receptor); Kinase, protein; Protein kinase, AGC; EC 2.7.11.11; AGC group; PKA family

Chromosomal Location of Human Ortholog: 9q13

Cellular Component: cytosol; nucleoplasm

Molecular Function: cAMP-dependent protein kinase activity; protein serine/threonine kinase activity

Biological Process: activation of protein kinase A; blood coagulation; lipoprotein metabolic process; male gonad development; renal water homeostasis; spermatogenesis; stimulatory C-type lectin receptor signaling pathway

Disease: Mental Retardation, Autosomal Dominant 31

Research Articles on PRKACG

Similar Products

Product Notes

The PRKACG prkacg (Catalog #AAA1270055) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcaacg cccccgccaa gaaggacacc gagcaggagg agagcgtgaa cgagttccta gccaaagcca gaggagattt cctctacaga tggggaaacc ccgctcaaaa caccgccagc tcggatcagt tcgaacggct caggacgctg ggcatgggct ccttcgggcg ggtgatgctg gtgaggcacc aggagaccgg cggccactac gccatgaaga tcctcaacaa gcagaaggtg gtgaagatga agcaggtcga gcacatactg aacgagaagc gcatcctgca ggcgatcgac tttccgttcc tcgtcaagct ccagttctcc tttaaggaca actcctacct gtacctggtg atggagtacg tgccgggtgg ggagatgttc tcccgcctac agcgcgtcgg aaggtttagc gagccccatg cctgtttcta tgccgcccag gtcgtcctgg ccgtccagta cctacactcg ctcgacctca tccaccgcga cctgaagccc gagaatctcc tcatcgacca gcagggctac ctgcaggtga cggacttcgg tttcgccaag cgcgtgaagg gccgcacttg gaccttgtgc gggaccccag agtacctggc ccccgagatc atcctgagca aaggctacaa caaggccgtg gactggtggg ccctaggggt gctcatctat gagatggccg tgggcttccc acccttctac gccgaccagc ccatccagat ctacgagaag atcgtctctg ggagggtgcg gtttccctcc aaactcagct ctgacctcaa gcatctgctg cggagcctgc tgcaggtgga cctcaccaag cgcttcggaa acctcaggaa cggggttggc gacatcaaga accacaagtg gttcgccaca accagctgga tcgccatcta tgagaagaag gtggaagctc ccttcatccc gaagtacaca ggccctgggg atgccagtaa ctttgacgac tacgaggagg aagagctccg gatctccatc aatgagaagt gtcccaagga gttttctgag ttttag. It is sometimes possible for the material contained within the vial of "PRKACG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.