Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRDX5 cdna clone

PRDX5 cDNA Clone

Gene Names
PRDX5; PLP; ACR1; B166; PRXV; PMP20; PRDX6; prx-V; SBBI10; AOEB166; HEL-S-55
Synonyms
PRDX5; PRDX5 cDNA Clone; PRDX5 cdna clone
Ordering
For Research Use Only!
Sequence
atgggactagctggcgtgtgcgccctgagacgctcagcgggctatatactcgtcggtggggccggcggtcagtctgcggcagcggcagcaagacggtgcagtgaaggagagtgggcgtctggcggggtccgcagtttcagcagagccgctgcagccatggccccaatcaaggtgggagatgccatcccagcagtggaggtgtttgaaggggagccagggaacaaggtgaacctggcagagctgttcaagggcaagaagggtgtgctgtttggagttcctggggccttcacccctggatgttccaagacacacctgccagggtttgtggagcaggctgaggctctgaaggccaagggagtccaggtggtggcctgtctgagtgttaatgatgcctttgtgactggcgagtggggccgagcccacaaggcggaaggcaaggttcggctcctggctgatcccactggggcctttgggaaggagacagacttattactagatgattcgctggtgtccatctttgggaatcgacgtctcaagaggttctccatggtggtacaggatggcatagtgaaggccctgaatgtggaaccagatggcacaggcctcacctgcagcctggcacccaatatcatctcacagctctga
Sequence Length
645
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,897 Da
NCBI Official Full Name
Homo sapiens peroxiredoxin 5, mRNA
NCBI Official Synonym Full Names
peroxiredoxin 5
NCBI Official Symbol
PRDX5
NCBI Official Synonym Symbols
PLP; ACR1; B166; PRXV; PMP20; PRDX6; prx-V; SBBI10; AOEB166; HEL-S-55
NCBI Protein Information
peroxiredoxin-5, mitochondrial
UniProt Protein Name
Peroxiredoxin-5, mitochondrial
Protein Family
UniProt Gene Name
PRDX5
UniProt Synonym Gene Names
ACR1; AOEB166; Prx-V
UniProt Entry Name
PRDX5_HUMAN

NCBI Description

This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. This protein interacts with peroxisome receptor 1. The crystal structure of this protein in its reduced form has been resolved to 1.5 angstrom resolution. This gene uses alternate in-frame translation initiation sites to generate mitochondrial or peroxisomal/cytoplasmic forms. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

PRDX5: Reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin system. Involved in intracellular redox signaling. Belongs to the peroxiredoxin 2 family. 2 isoforms of the human protein are produced by alternative initiation.

Protein type: EC 1.11.1.15; Oxidoreductase

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: cytoplasm; cytoplasmic vesicle; cytosol; extracellular space; intracellular membrane-bound organelle; mitochondrial matrix; mitochondrion; nucleus; perinuclear region of cytoplasm; peroxisome

Molecular Function: caspase inhibitor activity; peroxidase activity; protein dimerization activity; receptor binding; thioredoxin peroxidase activity

Biological Process: inflammatory response; negative regulation of apoptosis; negative regulation of transcription from RNA polymerase III promoter; response to oxidative stress; response to reactive oxygen species

Research Articles on PRDX5

Similar Products

Product Notes

The PRDX5 prdx5 (Catalog #AAA1271357) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggactag ctggcgtgtg cgccctgaga cgctcagcgg gctatatact cgtcggtggg gccggcggtc agtctgcggc agcggcagca agacggtgca gtgaaggaga gtgggcgtct ggcggggtcc gcagtttcag cagagccgct gcagccatgg ccccaatcaa ggtgggagat gccatcccag cagtggaggt gtttgaaggg gagccaggga acaaggtgaa cctggcagag ctgttcaagg gcaagaaggg tgtgctgttt ggagttcctg gggccttcac ccctggatgt tccaagacac acctgccagg gtttgtggag caggctgagg ctctgaaggc caagggagtc caggtggtgg cctgtctgag tgttaatgat gcctttgtga ctggcgagtg gggccgagcc cacaaggcgg aaggcaaggt tcggctcctg gctgatccca ctggggcctt tgggaaggag acagacttat tactagatga ttcgctggtg tccatctttg ggaatcgacg tctcaagagg ttctccatgg tggtacagga tggcatagtg aaggccctga atgtggaacc agatggcaca ggcctcacct gcagcctggc acccaatatc atctcacagc tctga. It is sometimes possible for the material contained within the vial of "PRDX5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.