Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRAME cdna clone

PRAME cDNA Clone

Gene Names
PRAME; MAPE; OIP4; CT130; OIP-4
Synonyms
PRAME; PRAME cDNA Clone; PRAME cdna clone
Ordering
For Research Use Only!
Sequence
atggaacgaaggcgtttgcggggttccattcagagccgatacatcagcatgagtgtgtggacaagcccacggagacttgtggagctggcagggcagagcctgctgaaggatgaggccctggccattgccgccctggagttgctgcccagggagctcttcccgccactcttcatggcagcctttgacgggagacacagccagaccctgaaggcaatggtgcaggcctggcccttcacctgcctccctctgggagtgctgatgaagggacaacatcttcacctggagaccttcaaagctgtgcttgatggacttgatgtgctccttgcccaggaggttcgccccaggaggtggaaacttcaagtgctggatttacggaagaactctcatcaggacttctggactgtatggtctggaaacagggccagtctgtactcatttccagagccagaagcagctcagcccatgacaaagaagcgaaaagtagatggtttgagcacagaggcagagcagcccttcattccagtagaggtgctcgtagacctgttcctcaaggaaggtgcctgtgatgaattgttctcctacctcattgagaaagtgaagcgaaagaaaaatgtactacgcctgtgctgtaagaagctgaagatttttgcaatgcccatgcaggatatcaagatgatcctgaaaatggtgcagctggactctattgaagatttggaagtgacttgtacctggaagctacccaccttggcgaaattttctccttacctgggccagatgattaatctgcgtagactcctcctctcccacatccatgcatcttcctacatttccccggagaaggaagagcagtatatcgcccagttcacctctcagttcctcagtctgcagtgcctgcaggctctctatgtggactctttatttttccttagaggccgcctggatcagttgctcaggcacgtgatgaaccccttggaaaccctctcaataactaactgccggctttcggaaggggatgtgatgcatctgtcccagagtcccagcgtcagtcagctaagtgtcctgagtctaagtggggtcatgctgaccgatgtaagtcccgagcccctccaagctctgctggagagagcctctgccaccctccaggacctggtctttgatgagtgtgggatcacggatgatcagctccttgccctcctgccttccctgagccactgctcccagcttacaaccttaagcttctacgggaattccatctccatatctgccttgcagagtctcctgcagcacctcatcgggctgagcaatctgacccacgtgctgtatcctgtccccctggagagttatgaggacatccatggtaccctccacctggagaggcttgcctatctgcatgccaggctcagggagttgctgtgtgagttggggcggcccagcatggtctggcttagtgccaacccctgtcctcactgtggggacagaaccttctatgacccggagcccatcctgtgcccctgtttcatgcctaactag
Sequence Length
1530
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,890 Da
NCBI Official Full Name
Homo sapiens preferentially expressed antigen in melanoma, mRNA
NCBI Official Synonym Full Names
preferentially expressed antigen in melanoma
NCBI Official Symbol
PRAME
NCBI Official Synonym Symbols
MAPE; OIP4; CT130; OIP-4
NCBI Protein Information
melanoma antigen preferentially expressed in tumors
UniProt Protein Name
Melanoma antigen preferentially expressed in tumors
Protein Family
UniProt Gene Name
PRAME
UniProt Synonym Gene Names
MAPE; OIP4; OIP-4
UniProt Entry Name
PRAME_HUMAN

NCBI Description

This gene encodes an antigen that is preferentially expressed in human melanomas and that is recognized by cytolytic T lymphocytes. It is not expressed in normal tissues, except testis. The encoded protein acts as a repressor of retinoic acid receptor, and likely confers a growth advantage to cancer cells via this function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]

Uniprot Description

PRAME: Functions as a transcriptional repressor, inhibiting the signaling of retinoic acid through the retinoic acid receptors RARA, RARB and RARG. Prevents retinoic acid-induced cell proliferation arrest, differentiation and apoptosis. Belongs to the PRAME family.

Protein type: Transcription, coactivator/corepressor; Cancer Testis Antigen (CTA); Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 22q11.22

Molecular Function: protein binding; retinoic acid receptor binding

Biological Process: negative regulation of apoptosis; negative regulation of cell differentiation; negative regulation of retinoic acid receptor signaling pathway; negative regulation of transcription, DNA-dependent; positive regulation of cell proliferation

Research Articles on PRAME

Similar Products

Product Notes

The PRAME prame (Catalog #AAA1276702) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacgaa ggcgtttgcg gggttccatt cagagccgat acatcagcat gagtgtgtgg acaagcccac ggagacttgt ggagctggca gggcagagcc tgctgaagga tgaggccctg gccattgccg ccctggagtt gctgcccagg gagctcttcc cgccactctt catggcagcc tttgacggga gacacagcca gaccctgaag gcaatggtgc aggcctggcc cttcacctgc ctccctctgg gagtgctgat gaagggacaa catcttcacc tggagacctt caaagctgtg cttgatggac ttgatgtgct ccttgcccag gaggttcgcc ccaggaggtg gaaacttcaa gtgctggatt tacggaagaa ctctcatcag gacttctgga ctgtatggtc tggaaacagg gccagtctgt actcatttcc agagccagaa gcagctcagc ccatgacaaa gaagcgaaaa gtagatggtt tgagcacaga ggcagagcag cccttcattc cagtagaggt gctcgtagac ctgttcctca aggaaggtgc ctgtgatgaa ttgttctcct acctcattga gaaagtgaag cgaaagaaaa atgtactacg cctgtgctgt aagaagctga agatttttgc aatgcccatg caggatatca agatgatcct gaaaatggtg cagctggact ctattgaaga tttggaagtg acttgtacct ggaagctacc caccttggcg aaattttctc cttacctggg ccagatgatt aatctgcgta gactcctcct ctcccacatc catgcatctt cctacatttc cccggagaag gaagagcagt atatcgccca gttcacctct cagttcctca gtctgcagtg cctgcaggct ctctatgtgg actctttatt tttccttaga ggccgcctgg atcagttgct caggcacgtg atgaacccct tggaaaccct ctcaataact aactgccggc tttcggaagg ggatgtgatg catctgtccc agagtcccag cgtcagtcag ctaagtgtcc tgagtctaag tggggtcatg ctgaccgatg taagtcccga gcccctccaa gctctgctgg agagagcctc tgccaccctc caggacctgg tctttgatga gtgtgggatc acggatgatc agctccttgc cctcctgcct tccctgagcc actgctccca gcttacaacc ttaagcttct acgggaattc catctccata tctgccttgc agagtctcct gcagcacctc atcgggctga gcaatctgac ccacgtgctg tatcctgtcc ccctggagag ttatgaggac atccatggta ccctccacct ggagaggctt gcctatctgc atgccaggct cagggagttg ctgtgtgagt tggggcggcc cagcatggtc tggcttagtg ccaacccctg tcctcactgt ggggacagaa ccttctatga cccggagccc atcctgtgcc cctgtttcat gcctaactag. It is sometimes possible for the material contained within the vial of "PRAME, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.