PQLC2 cdna clone
PQLC2 cDNA Clone
Synonyms
PQLC2; PQLC2 cDNA Clone; PQLC2 cdna clone
Sequence
atggaccaggcgctgtccctgtggttcctcctgggctggattggcggagactcctgcaacctcatcggctccttccttgctgaccagctgcccctgcagacctacacggctgtgtattatgtcttggcagacctggtgatgctgacgctgtacttttactacaagttcaggacgcgcccctctctgttgtctgcccccatcaactccgtgctgttgttcctcatggggatggcgtgcgccacaccgctgctgagtgctgctgggcccgtggctgcccctagggaagccttccgggggcgggcgctcctgtccgtggagtcgggcagcaagcccttcacccggcaggaagtcattggcttcgtcatcggctccatctccagcgtgttgtacctgctttcccggctgcctcagatccgcaccaacttcctccggaagtccacccaggggatctcctactctctgttcgcgctggtgatgctggggaacacgctgtatgggctgagcgtgctgctcaaaaaccccgaggagggccagagcgagggcagctacctgctgcaccacctgccctggcttgtgggcagcctgggcgtgctgctgctcgacaccatcatctccatccagttcctggtgtacaggcgcagcaccgccgcctcggagcttgagcccctcctccccagctga
Sequence Length
681
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,848 Da
NCBI Official Full Name
Homo sapiens PQ loop repeat containing 2, mRNA
NCBI Official Synonym Full Names
PQ loop repeat containing 2
NCBI Official Symbol
PQLC2
NCBI Protein Information
lysosomal amino acid transporter 1 homolog
UniProt Protein Name
Lysosomal amino acid transporter 1 homolog
Protein Family
UniProt Gene Name
PQLC2
UniProt Entry Name
LAAT1_HUMAN
Uniprot Description
PQLC2: Lysosomal lysine/arginine transporter that specifically mediates the export of lysine and arginine from lysosomes. Belongs to the laat-1 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 1p36.13
Cellular Component: intracellular membrane-bound organelle; lysosomal membrane
Molecular Function: arginine transmembrane transporter activity; basic amino acid transmembrane transporter activity; L-lysine transmembrane transporter activity
Biological Process: arginine transport; lysine transport
Research Articles on PQLC2
Similar Products
Product Notes
The PQLC2 pqlc2 (Catalog #AAA1276222) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaccagg cgctgtccct gtggttcctc ctgggctgga ttggcggaga ctcctgcaac ctcatcggct ccttccttgc tgaccagctg cccctgcaga cctacacggc tgtgtattat gtcttggcag acctggtgat gctgacgctg tacttttact acaagttcag gacgcgcccc tctctgttgt ctgcccccat caactccgtg ctgttgttcc tcatggggat ggcgtgcgcc acaccgctgc tgagtgctgc tgggcccgtg gctgccccta gggaagcctt ccgggggcgg gcgctcctgt ccgtggagtc gggcagcaag cccttcaccc ggcaggaagt cattggcttc gtcatcggct ccatctccag cgtgttgtac ctgctttccc ggctgcctca gatccgcacc aacttcctcc ggaagtccac ccaggggatc tcctactctc tgttcgcgct ggtgatgctg gggaacacgc tgtatgggct gagcgtgctg ctcaaaaacc ccgaggaggg ccagagcgag ggcagctacc tgctgcacca cctgccctgg cttgtgggca gcctgggcgt gctgctgctc gacaccatca tctccatcca gttcctggtg tacaggcgca gcaccgccgc ctcggagctt gagcccctcc tccccagctg a. It is sometimes possible for the material contained within the vial of "PQLC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
