Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPT1 cdna clone

PPT1 cDNA Clone

Gene Names
PPT1; PPT; CLN1; INCL
Synonyms
PPT1; PPT1 cDNA Clone; PPT1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtcgcccggctgcctgtggctcttggctgtggctctcctgccatggacctgcgcttctcgggcgctgcagcatctggacccgccggcgccgctgccgttggtgatctggcatgggatgggagacagctgttgcaatcccttaagcatgggtgctattaaaaaaatggtggagaagaaaatacctggaatttacgtcttatctttagagattgggaagaccctgatggaggacgtggagaacagcttcttcttgaatgtcaattcccaagtaacaacagtgtgtcaggcacttgctaaggatcctaaattgcagcaaggctacaatgctatgggattctcccagggaggccaatttctgagggcagtggctcagagatgcccttcacctcccatgatcaatctgatctcggttgggggacaacatcaaggtgtttttggactccctcgatgcccaggagagagctctcacatctgtgacttcatccgaaaaacactgaatgctggggcgtactccaaagttgttcaggaacgcctcgtgcaagccgaatactggcatgaccccataaaggaggatgtgtatcgcaaccacagcatcttcttggcagatataaatcaggagcggggtatcaatgagtcctacaagaaaaacctgatggccctgaagaagtttgtgatggtgaaattcctcaatgattccattgtggaccctgtagattcggagtggtttggattttacagaagtggccaagccaaggaaaccattcccttacaggagacctccctgtacacacaggaccgcctggggctaaaggaaatggacaatgcaggacagctagtgtttctggctacagaaggggaccatcttcagttgtctgaagaatggttttatgcccacatcataccattccttggatga
Sequence Length
921
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,094 Da
NCBI Official Full Name
Homo sapiens palmitoyl-protein thioesterase 1, mRNA
NCBI Official Synonym Full Names
palmitoyl-protein thioesterase 1
NCBI Official Symbol
PPT1
NCBI Official Synonym Symbols
PPT; CLN1; INCL
NCBI Protein Information
palmitoyl-protein thioesterase 1
UniProt Protein Name
Palmitoyl-protein thioesterase 1
UniProt Gene Name
PPT1
UniProt Synonym Gene Names
PPT; PPT-1
UniProt Entry Name
PPT1_HUMAN

NCBI Description

The protein encoded by this gene is a small glycoprotein involved in the catabolism of lipid-modified proteins during lysosomal degradation. The encoded enzyme removes thioester-linked fatty acyl groups such as palmitate from cysteine residues. Defects in this gene are a cause of infantile neuronal ceroid lipofuscinosis 1 (CLN1, or INCL) and neuronal ceroid lipofuscinosis 4 (CLN4). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2008]

Uniprot Description

PPT1: Removes thioester-linked fatty acyl groups such as palmitate from modified cysteine residues in proteins or peptides during lysosomal degradation. Prefers acyl chain lengths of 14 to 18 carbons. Defects in PPT1 are the cause of neuronal ceroid lipofuscinosis type 1 (CLN1). A form of neuronal ceroid lipofuscinosis with variable age at onset. Infantile, late- infantile, juvenile, and adult onset have been reported. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy. The lipopigment pattern seen most often in CLN1 is referred to as granular osmiophilic deposits (GROD). Belongs to the palmitoyl-protein thioesterase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipid Metabolism - fatty acid elongation in mitochondria; EC 3.1.2.22; Hydrolase

Chromosomal Location of Human Ortholog: 1p32

Cellular Component: axon; cytosol; extracellular region; Golgi apparatus; lipid raft; lysosomal lumen; lysosome; membrane; nucleus; synaptic vesicle

Molecular Function: palmitoyl-(protein) hydrolase activity; palmitoyl-CoA hydrolase activity

Biological Process: brain development; cofactor metabolic process; cofactor transport; lipid catabolic process; lipid raft organization and biogenesis; lysosomal lumen acidification; negative regulation of apoptosis; negative regulation of cell growth; negative regulation of neuron apoptosis; nervous system development; neuron development; pinocytosis; positive regulation of pinocytosis; positive regulation of receptor-mediated endocytosis; protein depalmitoylation; protein transport; receptor-mediated endocytosis; sphingolipid catabolic process; synaptic transmission

Disease: Ceroid Lipofuscinosis, Neuronal, 1

Research Articles on PPT1

Similar Products

Product Notes

The PPT1 ppt1 (Catalog #AAA1277960) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtcgc ccggctgcct gtggctcttg gctgtggctc tcctgccatg gacctgcgct tctcgggcgc tgcagcatct ggacccgccg gcgccgctgc cgttggtgat ctggcatggg atgggagaca gctgttgcaa tcccttaagc atgggtgcta ttaaaaaaat ggtggagaag aaaatacctg gaatttacgt cttatcttta gagattggga agaccctgat ggaggacgtg gagaacagct tcttcttgaa tgtcaattcc caagtaacaa cagtgtgtca ggcacttgct aaggatccta aattgcagca aggctacaat gctatgggat tctcccaggg aggccaattt ctgagggcag tggctcagag atgcccttca cctcccatga tcaatctgat ctcggttggg ggacaacatc aaggtgtttt tggactccct cgatgcccag gagagagctc tcacatctgt gacttcatcc gaaaaacact gaatgctggg gcgtactcca aagttgttca ggaacgcctc gtgcaagccg aatactggca tgaccccata aaggaggatg tgtatcgcaa ccacagcatc ttcttggcag atataaatca ggagcggggt atcaatgagt cctacaagaa aaacctgatg gccctgaaga agtttgtgat ggtgaaattc ctcaatgatt ccattgtgga ccctgtagat tcggagtggt ttggatttta cagaagtggc caagccaagg aaaccattcc cttacaggag acctccctgt acacacagga ccgcctgggg ctaaaggaaa tggacaatgc aggacagcta gtgtttctgg ctacagaagg ggaccatctt cagttgtctg aagaatggtt ttatgcccac atcataccat tccttggatg a. It is sometimes possible for the material contained within the vial of "PPT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.