Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP2R4 cdna clone

PPP2R4 cDNA Clone

Gene Names
PTPA; PP2A; PR53; PPP2R4
Synonyms
PPP2R4; PPP2R4 cDNA Clone; PPP2R4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgagggcgagcggcagccgccgccagattcttcagaggaggcccctccagccactcagaacttcatcattccaaaaaaggagatccacacagttccagacatgggcaaatggaagcgttctcaggcatacgctgactacatcggattcatccttaccctcaacgaaggtgtgaaggggaagaagctgaccttcgagtacagagtctccgaggccattgagaaactagtcgctcttctcaacacgctggacaggtggattgatgagactcctccagtggaccagccctctcggtttgggaataaggcatacaggacctggtatgccaaacttgatgaggaagcagaaaacttggtggccacagtggtccctacccatctggcagctgctgtgcctgaggtggctgtttacctaaaggagtcagtggggaactccacgcgcattgactacggcacagggcatgaggcagccttcgctgctttcctctgctgtctctgcaagattggggtgctccgggtggatgaccaaatagctattgtcttcaaggtgttcaatcggtaccttgaggttatgcggaaactccagaaaacatacaggatggagccagccggcagccagggagtgtggggtctggatgacttccagtttctgcccttcatctggggcagttcgcagctgatagaccacccatacctggagcccagacactttgtggatgagaaggccgtgaatgagaaccacaaggactacatgttcctggagtgtatcctgtttattaccgagatgaagactggcccatttgcagagcactccaaccagctgtggaacatcagcgccgtcccttcctggtccaaagtgaaccagggtctcatccgcatgtataaggccgagtgcctggagaagttccctgtgatccagcacttcaagttcgggagcctgctgcccatccatcctgtcacgtcgggctag
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,859 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 2A activator, regulatory subunit 4, mRNA
NCBI Official Synonym Full Names
protein phosphatase 2 phosphatase activator
NCBI Official Symbol
PTPA
NCBI Official Synonym Symbols
PP2A; PR53; PPP2R4
NCBI Protein Information
serine/threonine-protein phosphatase 2A activator
UniProt Protein Name
Serine/threonine-protein phosphatase 2A activator
UniProt Gene Name
PPP2R4
UniProt Synonym Gene Names
PTPA; PTPA
UniProt Entry Name
PTPA_HUMAN

NCBI Description

Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

PPP2R4: PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. Acts as a regulatory subunit for serine/threonine- protein phosphatase 2A (PP2A) modulating its activity or substrate specificity, probably by inducing a conformational change in the catalytic subunit, a proposed direct target of the PPIase. Can reactivate inactive phosphatase PP2A-phosphatase methylesterase complexes (PP2A(i)) in presence of ATP and Mg(2+). Reversibly stimulates the variable phosphotyrosyl phosphatase activity of PP2A core heterodimer PP2A(D) in presence of ATP and Mg(2+) (in vitro). The phosphotyrosyl phosphatase activity is dependent of an ATPase activty of the PP2A(D):PPP2R4 complex. Is involved in apoptosis; the function appears to be independent from PP2A. Associates with PP2A heterodimeric core enzyme PP2A(D), composed of a 36 kDa catalytic subunit (subunit C) and a 65 kDa constant regulatory subunit (PR65 or subunit A). Interacts with PPP2CB. Widely expressed. Belongs to the PTPA-type PPIase family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 5.2.1.8; Protein phosphatase, regulatory subunit; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 9q34

Cellular Component: cytoplasm; nucleoplasm; nucleus; protein phosphatase type 2A complex

Molecular Function: ATP binding; ATPase activity; peptidyl-prolyl cis-trans isomerase activity; protein binding; protein heterodimerization activity; protein homodimerization activity; protein phosphatase 2A binding; protein phosphatase type 2A regulator activity; protein tyrosine phosphatase activator activity; receptor binding

Biological Process: mitotic spindle organization and biogenesis in nucleus; negative regulation of phosphoprotein phosphatase activity; negative regulation of protein amino acid dephosphorylation; positive regulation of apoptosis; positive regulation of phosphoprotein phosphatase activity; positive regulation of protein amino acid dephosphorylation; regulation of phosphoprotein phosphatase activity

Research Articles on PPP2R4

Similar Products

Product Notes

The PPP2R4 ppp2r4 (Catalog #AAA1270769) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgagg gcgagcggca gccgccgcca gattcttcag aggaggcccc tccagccact cagaacttca tcattccaaa aaaggagatc cacacagttc cagacatggg caaatggaag cgttctcagg catacgctga ctacatcgga ttcatcctta ccctcaacga aggtgtgaag gggaagaagc tgaccttcga gtacagagtc tccgaggcca ttgagaaact agtcgctctt ctcaacacgc tggacaggtg gattgatgag actcctccag tggaccagcc ctctcggttt gggaataagg catacaggac ctggtatgcc aaacttgatg aggaagcaga aaacttggtg gccacagtgg tccctaccca tctggcagct gctgtgcctg aggtggctgt ttacctaaag gagtcagtgg ggaactccac gcgcattgac tacggcacag ggcatgaggc agccttcgct gctttcctct gctgtctctg caagattggg gtgctccggg tggatgacca aatagctatt gtcttcaagg tgttcaatcg gtaccttgag gttatgcgga aactccagaa aacatacagg atggagccag ccggcagcca gggagtgtgg ggtctggatg acttccagtt tctgcccttc atctggggca gttcgcagct gatagaccac ccatacctgg agcccagaca ctttgtggat gagaaggccg tgaatgagaa ccacaaggac tacatgttcc tggagtgtat cctgtttatt accgagatga agactggccc atttgcagag cactccaacc agctgtggaa catcagcgcc gtcccttcct ggtccaaagt gaaccagggt ctcatccgca tgtataaggc cgagtgcctg gagaagttcc ctgtgatcca gcacttcaag ttcgggagcc tgctgcccat ccatcctgtc acgtcgggct ag. It is sometimes possible for the material contained within the vial of "PPP2R4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.