Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP2R2C cdna clone

PPP2R2C cDNA Clone

Gene Names
PPP2R2C; PR52; PR55G; IMYPNO; IMYPNO1; B55-GAMMA
Synonyms
PPP2R2C; PPP2R2C cDNA Clone; PPP2R2C cdna clone
Ordering
For Research Use Only!
Sequence
atgggaaagagagacacggctgacatcatctctaccgttgagttcaaccacacgggagagctgctggccacaggtgacaagggcggccgggtcgtcatcttccagcgggaaccagagagtaaaaatgcgccccacagccagggcgaatacgacgtgtacagcactttccagagccacgagccggagtttgactatctcaagagcctggagatagaggagaagatcaacaagatcaagtggctcccacagcagaacgccgcccactcactcctgtccaccaacgataaaactatcaaattatggaagattaccgaacgagataaaaggcccgaaggatacaacctgaaggatgaagaggggaaacttaaggacctgtccacggtgacgtcactgcaggtgccagtgctgaagcccatggatctgatggtggaggtgagccctcggaggatctttgccaatggccacacctaccacatcaactccatctccgtcaacagtgactgcgagacctacatgtcggcggatgacctgcgcatcaacctctggcacctggccatcaccgacaggagcttcaacatcgtggacatcaagccggccaacatggaggaccttacggaggtgatcacagcatctgagttccatccgcaccactgcaacctcttcgtctacagcagcagcaagggctccctgcggctctgcgacatgcgggcagctgccctgtgtgacaagcattccaagctctttgaagagcctgaggaccccagtaaccgctcattcttctcggaaatcatctcctccgtgtccgacgtgaagttcagccacagcggccgctacatgctcacccgggactaccttacagtcaaggtctgggacctgaacatggaggcaagacccatagagacctaccaggtccatgactaccttcggagcaagctctgttccctgtacgagaacgactgcattttcgacaagtttgaatgtgcctggaacgggagcgacagcgtcatcatgaccggggcctacaacaacttcttccgcatgttcgatcggaacaccaagcgggacgtgaccctggaggcctcgagggaaagcagcaagccccgggctgtgctcaagccacggcgcgtgtgcgtggggggcaagcgccggcgtgatgacatcagtgtggacagcttggacttcaccaagaagatcctgcacacggcctggcacccggctgagaacatcattgccattgccgccaccaacaacctgtacatcttccaggacaaggtaaactctgacatgcactag
Sequence Length
1293
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,636 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform, mRNA
NCBI Official Synonym Full Names
protein phosphatase 2 regulatory subunit Bgamma
NCBI Official Symbol
PPP2R2C
NCBI Official Synonym Symbols
PR52; PR55G; IMYPNO; IMYPNO1; B55-GAMMA
NCBI Protein Information
protein phosphatase 2, regulatory subunit B, gamma
UniProt Protein Name
Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B gamma isoform
UniProt Gene Name
PPP2R2C
UniProt Entry Name
2ABG_HUMAN

NCBI Description

The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

PPP2R2C: The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment. Belongs to the phosphatase 2A regulatory subunit B family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein phosphatase, regulatory subunit

Chromosomal Location of Human Ortholog: 4p16.1

Molecular Function: protein binding

Research Articles on PPP2R2C

Similar Products

Product Notes

The PPP2R2C ppp2r2c (Catalog #AAA1267024) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaaaga gagacacggc tgacatcatc tctaccgttg agttcaacca cacgggagag ctgctggcca caggtgacaa gggcggccgg gtcgtcatct tccagcggga accagagagt aaaaatgcgc cccacagcca gggcgaatac gacgtgtaca gcactttcca gagccacgag ccggagtttg actatctcaa gagcctggag atagaggaga agatcaacaa gatcaagtgg ctcccacagc agaacgccgc ccactcactc ctgtccacca acgataaaac tatcaaatta tggaagatta ccgaacgaga taaaaggccc gaaggataca acctgaagga tgaagagggg aaacttaagg acctgtccac ggtgacgtca ctgcaggtgc cagtgctgaa gcccatggat ctgatggtgg aggtgagccc tcggaggatc tttgccaatg gccacaccta ccacatcaac tccatctccg tcaacagtga ctgcgagacc tacatgtcgg cggatgacct gcgcatcaac ctctggcacc tggccatcac cgacaggagc ttcaacatcg tggacatcaa gccggccaac atggaggacc ttacggaggt gatcacagca tctgagttcc atccgcacca ctgcaacctc ttcgtctaca gcagcagcaa gggctccctg cggctctgcg acatgcgggc agctgccctg tgtgacaagc attccaagct ctttgaagag cctgaggacc ccagtaaccg ctcattcttc tcggaaatca tctcctccgt gtccgacgtg aagttcagcc acagcggccg ctacatgctc acccgggact accttacagt caaggtctgg gacctgaaca tggaggcaag acccatagag acctaccagg tccatgacta ccttcggagc aagctctgtt ccctgtacga gaacgactgc attttcgaca agtttgaatg tgcctggaac gggagcgaca gcgtcatcat gaccggggcc tacaacaact tcttccgcat gttcgatcgg aacaccaagc gggacgtgac cctggaggcc tcgagggaaa gcagcaagcc ccgggctgtg ctcaagccac ggcgcgtgtg cgtggggggc aagcgccggc gtgatgacat cagtgtggac agcttggact tcaccaagaa gatcctgcac acggcctggc acccggctga gaacatcatt gccattgccg ccaccaacaa cctgtacatc ttccaggaca aggtaaactc tgacatgcac tag. It is sometimes possible for the material contained within the vial of "PPP2R2C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.