Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP2R1A cdna clone

PPP2R1A cDNA Clone

Gene Names
PPP2R1A; MRD36; PR65A; PP2AAALPHA; PP2A-Aalpha
Synonyms
PPP2R1A; PPP2R1A cDNA Clone; PPP2R1A cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggccgacggcgacgactcgctgtaccccatcgcggtgctcatagacgaactccgcaatgaggacgttcagcttcgcctcaacagcatcaagaagctgtccaccatcgccttggcccttggggttgaaaggacccgaagtgagcttctgcctttccttacagataccatctatgatgaagatgaggtcctcctggccctggcagaacagctgggaaccttcactaccctggtgggaggcccagagtacgtgcactgcctgctgccaccgctggagtcgctggccacagtggaggagacagtggtgcgggacaaggcagtggagtccttacgggccatctcacacgagcactcgccctctgacctggaggcgcactttgtgccgctagtgaagcggctggcgggcggcgactggttcacctcccgcacctcggcctgcggcctcttctccgtctgctacccccgagtgtccagtgctgtgaaggcggaacttcgacagtacttccggaacctgtgctcagatgacacccccatggtgcggcgggccgcagcctccaagctgggggagtttgccaaggtgctggagctggacaacgtcaagagtgagatcatccccatgttctccaacctggcctctgacgagcaggactcggtgcggctgctggcggtggaggcgtgcgtgaacatcgcccagcttctgccccaggaggatctggaggccctggtgatgcccactctgcgccaggccgctgaagacaagtcctggcgcgtccgctacatggtggctgacaagttcacagagctccagaaagcagtggggcctgagatcaccaagacagacctggtccctgccttccagaacctgatgaaagactgtgaggccgaggtgagggccgcagcctcccacaaggtcaaagagttctgtgaaaacctctcagctgactgtcgggagaatgtgatcatgtcccagatcttgccctgcatcaaggagctggtgtccgatgccaaccaacatgtcaagtctgccctggcctcagtcatcatgggtctctctcccatcttgggcaaagacaacaccatcgagcacctcttgcccctcttcctggctcagctgaaggatgagtgccctgaggtacggctgaacatcatctctaacctggactgtgtgaacgaggtgattggcatccggcagctgtcccagtccctgctccctgccattgtggagctggctgaggacgccaagtggcgggtgcggctggccatcattgagtacatgcccctcctggctggacagctgggagtggagttctttgatgagaaacttaactccttgtgcatggcctggcttgtggatcatgtatatgccatccgcgaggcagccaccagcaacctgaagaagctagtggaaaagtttgggaaggagtgggcccatgccacaatcatccccaaggtcttggccatgtccggagaccccaactacctgcaccgcatgactacgctcttctgcatcaatgtgctgtctgaggtctgtgggcaggacatcaccaccaagcacatgctacccacggttctgcgcatggctggggacccggttgccaatgtccgcttcaatgtggccaagtctctgcagaagatagggcccatcctggacaacagcaccttgcagagtgaagtcaagcccatcctagagaagctgacccaggaccaggatgtggacgtcaaatactttgcccaggaggctctgactgttctgtctctcgcctga
Sequence Length
1770
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,309 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform, mRNA
NCBI Official Synonym Full Names
protein phosphatase 2 scaffold subunit Aalpha
NCBI Official Symbol
PPP2R1A
NCBI Official Synonym Symbols
MRD36; PR65A; PP2AAALPHA; PP2A-Aalpha
NCBI Protein Information
serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A alpha isoform
UniProt Protein Name
Serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A alpha isoform
UniProt Gene Name
PPP2R1A
UniProt Entry Name
2AAA_HUMAN

NCBI Description

This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]

Uniprot Description

PPP2R1A: The PR65 subunit of protein phosphatase 2A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. Required for proper chromosome segregation and for centromeric localization of SGOL1 in mitosis. Found in a complex with at least ARL2, PPP2CB, PPP2R1A, PPP2R2A, PPP2R5E and TBCD. PP2A consists of a common heterodimeric core enzyme, composed of PPP2CA a 36 kDa catalytic subunit (subunit C) and PPP2R1A a 65 kDa constant regulatory subunit (PR65 or subunit A), that associates with a variety of regulatory subunits. Proteins that associate with the core dimer include three families of regulatory subunits B (the R2/B/PR55/B55, R3/B''/PR72/PR130/PR59 and R5/B'/B56 families), the 48 kDa variable regulatory subunit, viral proteins, and cell signaling molecules. Interacts with IPO9. Interacts with TP53 and SGOL1. Interacts with PLA2G16; this interaction might decrease PP2A activity. Belongs to the phosphatase 2A regulatory subunit A family.

Protein type: Protein phosphatase, regulatory subunit; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 19q13.41

Cellular Component: chromosome, pericentric region; cytosol; protein phosphatase type 2A complex

Molecular Function: antigen binding; protein binding; protein heterodimerization activity; protein phosphatase type 2A regulator activity

Biological Process: apoptosis; chromosome segregation; G2/M transition of mitotic cell cycle; mitotic nuclear envelope reassembly; mRNA catabolic process, nonsense-mediated decay; protein amino acid dephosphorylation; protein complex assembly

Disease: Mental Retardation, Autosomal Dominant 36

Research Articles on PPP2R1A

Similar Products

Product Notes

The PPP2R1A ppp2r1a (Catalog #AAA1275782) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg ccgacggcga cgactcgctg taccccatcg cggtgctcat agacgaactc cgcaatgagg acgttcagct tcgcctcaac agcatcaaga agctgtccac catcgccttg gcccttgggg ttgaaaggac ccgaagtgag cttctgcctt tccttacaga taccatctat gatgaagatg aggtcctcct ggccctggca gaacagctgg gaaccttcac taccctggtg ggaggcccag agtacgtgca ctgcctgctg ccaccgctgg agtcgctggc cacagtggag gagacagtgg tgcgggacaa ggcagtggag tccttacggg ccatctcaca cgagcactcg ccctctgacc tggaggcgca ctttgtgccg ctagtgaagc ggctggcggg cggcgactgg ttcacctccc gcacctcggc ctgcggcctc ttctccgtct gctacccccg agtgtccagt gctgtgaagg cggaacttcg acagtacttc cggaacctgt gctcagatga cacccccatg gtgcggcggg ccgcagcctc caagctgggg gagtttgcca aggtgctgga gctggacaac gtcaagagtg agatcatccc catgttctcc aacctggcct ctgacgagca ggactcggtg cggctgctgg cggtggaggc gtgcgtgaac atcgcccagc ttctgcccca ggaggatctg gaggccctgg tgatgcccac tctgcgccag gccgctgaag acaagtcctg gcgcgtccgc tacatggtgg ctgacaagtt cacagagctc cagaaagcag tggggcctga gatcaccaag acagacctgg tccctgcctt ccagaacctg atgaaagact gtgaggccga ggtgagggcc gcagcctccc acaaggtcaa agagttctgt gaaaacctct cagctgactg tcgggagaat gtgatcatgt cccagatctt gccctgcatc aaggagctgg tgtccgatgc caaccaacat gtcaagtctg ccctggcctc agtcatcatg ggtctctctc ccatcttggg caaagacaac accatcgagc acctcttgcc cctcttcctg gctcagctga aggatgagtg ccctgaggta cggctgaaca tcatctctaa cctggactgt gtgaacgagg tgattggcat ccggcagctg tcccagtccc tgctccctgc cattgtggag ctggctgagg acgccaagtg gcgggtgcgg ctggccatca ttgagtacat gcccctcctg gctggacagc tgggagtgga gttctttgat gagaaactta actccttgtg catggcctgg cttgtggatc atgtatatgc catccgcgag gcagccacca gcaacctgaa gaagctagtg gaaaagtttg ggaaggagtg ggcccatgcc acaatcatcc ccaaggtctt ggccatgtcc ggagacccca actacctgca ccgcatgact acgctcttct gcatcaatgt gctgtctgag gtctgtgggc aggacatcac caccaagcac atgctaccca cggttctgcg catggctggg gacccggttg ccaatgtccg cttcaatgtg gccaagtctc tgcagaagat agggcccatc ctggacaaca gcaccttgca gagtgaagtc aagcccatcc tagagaagct gacccaggac caggatgtgg acgtcaaata ctttgcccag gaggctctga ctgttctgtc tctcgcctga. It is sometimes possible for the material contained within the vial of "PPP2R1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.