PPP1R2P3 cdna clone
PPP1R2P3 cDNA Clone
Synonyms
PPP1R2P3; PPP1R2P3 cDNA Clone; PPP1R2P3 cdna clone
Sequence
atggcggcctcgacggcctcccaccggcccatcaaggggatcttgaagaacaagacctctacgacttcctctatggtggcgtcggccgaacagccccgcaggagtgtcgacgaggagctgagcaaaaaatcccagaagtgggatgaaattaacatcttggcgacctatcatccagcagacaaaggctatggtttaatgaaaatagatgaaccaagccctccttaccatagtatgatgggtgatgatgaagatgcgtgtagggacaccgagaccactgaagccatggcgccaggcatcctagccaagaaattagctgctgctgaaggcttggagccaaagtaccggattcaggaacaagaaagcagtggagaggaggatagtgacctctcacctgaagaacgagaaaaaaagcgacaatttgaaatgagaaggaagcttcactacaatgaaggactcaatatcaaactagccagacaattaatttcaaaagacctacatgatgatgatgaagatgaagaaatgttagagactgcagatggagaaagcatgaatacggaagaatcaaatcaaggatctactccaagtgaccaacagcaaaacaaattacgaagttcatag
Sequence Length
618
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,048 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene 3, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory inhibitor subunit 2 pseudogene 3
NCBI Official Symbol
PPP1R2P3
UniProt Protein Name
Protein phosphatase inhibitor 2-like protein 3
Protein Family
UniProt Gene Name
PPP1R2P3
UniProt Entry Name
IPP2M_HUMAN
Uniprot Description
PPP1R2P3: Inhibitor of protein-phosphatase 1 (By similarity). Previously thought to be an intron-less pseudogene
Chromosomal Location of Human Ortholog: 5q33.3
Cellular Component: protein phosphatase type 1 complex
Molecular Function: protein binding; protein phosphatase inhibitor activity
Biological Process: regulation of phosphoprotein phosphatase activity
Research Articles on PPP1R2P3
1. PPP1R2P3 protein binds directly to PPP1CC and that this inhibitor cannot be phosphorylated by GSK3.
Similar Products
Product Notes
The PPP1R2P3 ppp1r2p3 (Catalog #AAA1265688) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcct cgacggcctc ccaccggccc atcaagggga tcttgaagaa caagacctct acgacttcct ctatggtggc gtcggccgaa cagccccgca ggagtgtcga cgaggagctg agcaaaaaat cccagaagtg ggatgaaatt aacatcttgg cgacctatca tccagcagac aaaggctatg gtttaatgaa aatagatgaa ccaagccctc cttaccatag tatgatgggt gatgatgaag atgcgtgtag ggacaccgag accactgaag ccatggcgcc aggcatccta gccaagaaat tagctgctgc tgaaggcttg gagccaaagt accggattca ggaacaagaa agcagtggag aggaggatag tgacctctca cctgaagaac gagaaaaaaa gcgacaattt gaaatgagaa ggaagcttca ctacaatgaa ggactcaata tcaaactagc cagacaatta atttcaaaag acctacatga tgatgatgaa gatgaagaaa tgttagagac tgcagatgga gaaagcatga atacggaaga atcaaatcaa ggatctactc caagtgacca acagcaaaac aaattacgaa gttcatag. It is sometimes possible for the material contained within the vial of "PPP1R2P3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
