PPP1R1A cdna clone
PPP1R1A cDNA Clone
Gene Names
PPP1R1A; I1; IPP1
Synonyms
PPP1R1A; PPP1R1A cDNA Clone; PPP1R1A cdna clone
Sequence
atggagcaagacaacagcccccaaaagatccagttcacggtcccgctgctggagccgcaccttgaccccgaggcggcggagcagattcggaggcgccgccccacccctgccaccctcgtgctgaccagtgaccagtcatccccagagatagatgaagaccggatccccaacccacatctcaagtccactttggcaatgtctccacggcaacggaagaagatgacaaggatcacacccacaatgaaagagctccagatgatggttgaacatcacctggggcaacagcagcaaggagaggaacctgagggggccgctgagagcacaggaacccaggagtcccgcccacctgggatcccagacacagaagtggagtcaaggctgggcacctctgggacagcaaaaaaaactgcagaatgcatccctaaaactcacgaaagaggcagtaaggaacccagcacaaaagaaccctcaacccatataccaccactggattccaagggagccaactcggtctga
Sequence Length
516
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,011 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1A, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory inhibitor subunit 1A
NCBI Official Symbol
PPP1R1A
NCBI Official Synonym Symbols
I1; IPP1
NCBI Protein Information
protein phosphatase 1 regulatory subunit 1A
UniProt Protein Name
Protein phosphatase 1 regulatory subunit 1A
Protein Family
UniProt Gene Name
PPP1R1A
UniProt Synonym Gene Names
IPP1; I-1; IPP-1
UniProt Entry Name
PPR1A_HUMAN
Uniprot Description
PPP1R1A: protein phosphatase 1, regulatory (inhibitor) subunit 1A. I-1 activation may impose cAMP control over proteins that are not directly phosphorylated by PKA. Following a rise in intracellular calcium, I-1 is inactivated by calcineurin (or PP2B). Does not inhibit type-2 phosphatases.
Protein type: Inhibitor; Protein phosphatase, regulatory subunit
Chromosomal Location of Human Ortholog: 12q13.2
Cellular Component: cytoplasm
Molecular Function: protein binding; type 1 serine/threonine specific protein phosphatase inhibitor activity
Biological Process: negative regulation of protein kinase activity
Research Articles on PPP1R1A
Similar Products
Product Notes
The PPP1R1A ppp1r1a (Catalog #AAA1266341) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcaag acaacagccc ccaaaagatc cagttcacgg tcccgctgct ggagccgcac cttgaccccg aggcggcgga gcagattcgg aggcgccgcc ccacccctgc caccctcgtg ctgaccagtg accagtcatc cccagagata gatgaagacc ggatccccaa cccacatctc aagtccactt tggcaatgtc tccacggcaa cggaagaaga tgacaaggat cacacccaca atgaaagagc tccagatgat ggttgaacat cacctggggc aacagcagca aggagaggaa cctgaggggg ccgctgagag cacaggaacc caggagtccc gcccacctgg gatcccagac acagaagtgg agtcaaggct gggcacctct gggacagcaa aaaaaactgc agaatgcatc cctaaaactc acgaaagagg cagtaaggaa cccagcacaa aagaaccctc aacccatata ccaccactgg attccaaggg agccaactcg gtctga. It is sometimes possible for the material contained within the vial of "PPP1R1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
