Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP1R15A cdna clone

PPP1R15A cDNA Clone

Gene Names
PPP1R15A; GADD34
Synonyms
PPP1R15A; PPP1R15A cDNA Clone; PPP1R15A cdna clone
Ordering
For Research Use Only!
Sequence
atggccccaggccaagcaccccatcaggctaccccgtggagggatgcccaccctttcttcctcctgtccccagtgatgggcctcctcagccgcgcctggagccgcctgaggggcctgggacctctagagccctggctggtggaagcagtaaaaggagcagctctggtagaagctggcctggagggagaagctaggactcctctggcaatcccccataccccttggggcagacgccctgaagaggaggctgaagacagtggaggccctggagaggacagagaaacactggggctgaaaaccagcagttcccttcctgaagcctggggacttttggatgatgatgatggcatgtatggtgagcgagaggcaaccagtgtccctagagggcagggaagtcaatttgcagatggccagcgtgctcccctgtctcccagccttctgataaggacactgcaaggttctgataagaacccaggggaggagaaagccgaggaagagggagttgctgaagaggagggagttaacaagttctcttatccaccatcacaccgggagtgttgtccagccgtggaggaggaggacgatgaagaagctgtaaagaaagaagctcacagaacctctacttctgccttgtctccaggatccaagcccagcacttgggtgtcttgcccaggggaggaagagaatcaagccacggaggataaaagaacagaaagaagtaaaggagccaggaagacctccgtgtccccccgatcttcaggctccgaccccaggtcctgggagtatcgttcaggagaggcgtccgaggagaaggaggaaaaggcacacaaagaaactgggaaaggagaagctgccccagggccgcaatcctcagccccagcccagaggccccagctcaagtcctggtggtgccaacccagtgatgaagaggagggtgaggtcaaggctttgggggcagctgagaaggatggagaagctgagtgtcctccctgcatccccccaccaagtgccttcctgaaggcctgggtgtattggccaggagaggacacagaggaagaggaagatgaggaagaagatgaggacagtgactctggatcagatgaggaagagggagaagctgaggcttcctcttccactcctgctacaggtgtcttcttgaagtcctgggtctatcagccaggagaggacacagaggaggaggaagatgaggacagtgatacaggatcagccgaggatgaaagagaagctgagacttctgcttccacaccccctgcaagtgctttcttgaaggcctgggtgtatcggccaggagaggacacggaggaggaggaagatgaggatgtggatagtgaggataaggaagatgattcagaagcagccttgggagaagctgagtcagacccacatccctcccacccggaccagagggcccacttcaggggctggggatatcgacctggaaaagagacagaggaagaggaagctgctgaggactggggagaagctgagccctgccccttccgagtggccatctatgtacctggagagaagccaccgcctccctgggctcctcctaggctgcccctccgactgcaaaggcggctcaagcgcccagaaacccctactcatgatccggaccctgagactcccctaaaggccagaaaggtgcgcttctccgagaaggtcactgtccatttcctggctgtctgggcagggccggcccaggccgcccgccagggcccctgggagcagcttgctcgggatcgcagccgcttcgcacgccgcatcacccaggcccaggaggagctgagcccctgcctcacccctgctgcccgggccagagcctgggcacgcctcaggaacccacctttagcccccatccctgccctcacccagaccttgccttcctcctctgtcccttcgtccccagtccagaccacgcccttgagccaagctgtggccacaccttcccgctcgtctgctgctgcagcggctgccctggacctcagtgggaggcgtggctga
Sequence Length
2025
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,515 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 15A, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory subunit 15A
NCBI Official Symbol
PPP1R15A
NCBI Official Synonym Symbols
GADD34
NCBI Protein Information
protein phosphatase 1 regulatory subunit 15A
UniProt Protein Name
Protein phosphatase 1 regulatory subunit 15A
UniProt Gene Name
PPP1R15A
UniProt Synonym Gene Names
GADD34
UniProt Entry Name
PR15A_HUMAN

NCBI Description

This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The induction of this gene by ionizing radiation occurs in certain cell lines regardless of p53 status, and its protein response is correlated with apoptosis following ionizing radiation. [provided by RefSeq, Jul 2008]

Uniprot Description

GADD34: Recruits the serine/threonine-protein phosphatase PP1 to dephosphorylate the translation initiation factor eIF-2A/EIF2S1, thereby reversing the shut-off of protein synthesis initiated by stress-inducible kinases and facilitating recovery of cells from stress. Down-regulates the TGF-beta signaling pathway by promoting dephosphorylation of TGFB1 by PP1. May promote apoptosis by inducing TP53 phosphorylation on 'Ser-15'. Belongs to the PPP1R15 family.

Protein type: Cell cycle regulation; Apoptosis; Translation initiation; DNA repair, damage

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum; Golgi apparatus; membrane; mitochondrion; protein phosphatase type 1 complex

Molecular Function: protein binding; protein kinase binding; protein phosphatase 1 binding; protein phosphatase type 1 regulator activity

Biological Process: apoptosis; cell cycle arrest; negative regulation of phosphoprotein phosphatase activity; negative regulation of protein amino acid dephosphorylation; positive regulation of phosphoprotein phosphatase activity; positive regulation of translation initiation in response to stress; response to DNA damage stimulus

Research Articles on PPP1R15A

Similar Products

Product Notes

The PPP1R15A ppp1r15a (Catalog #AAA1270486) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccccag gccaagcacc ccatcaggct accccgtgga gggatgccca ccctttcttc ctcctgtccc cagtgatggg cctcctcagc cgcgcctgga gccgcctgag gggcctggga cctctagagc cctggctggt ggaagcagta aaaggagcag ctctggtaga agctggcctg gagggagaag ctaggactcc tctggcaatc ccccataccc cttggggcag acgccctgaa gaggaggctg aagacagtgg aggccctgga gaggacagag aaacactggg gctgaaaacc agcagttccc ttcctgaagc ctggggactt ttggatgatg atgatggcat gtatggtgag cgagaggcaa ccagtgtccc tagagggcag ggaagtcaat ttgcagatgg ccagcgtgct cccctgtctc ccagccttct gataaggaca ctgcaaggtt ctgataagaa cccaggggag gagaaagccg aggaagaggg agttgctgaa gaggagggag ttaacaagtt ctcttatcca ccatcacacc gggagtgttg tccagccgtg gaggaggagg acgatgaaga agctgtaaag aaagaagctc acagaacctc tacttctgcc ttgtctccag gatccaagcc cagcacttgg gtgtcttgcc caggggagga agagaatcaa gccacggagg ataaaagaac agaaagaagt aaaggagcca ggaagacctc cgtgtccccc cgatcttcag gctccgaccc caggtcctgg gagtatcgtt caggagaggc gtccgaggag aaggaggaaa aggcacacaa agaaactggg aaaggagaag ctgccccagg gccgcaatcc tcagccccag cccagaggcc ccagctcaag tcctggtggt gccaacccag tgatgaagag gagggtgagg tcaaggcttt gggggcagct gagaaggatg gagaagctga gtgtcctccc tgcatccccc caccaagtgc cttcctgaag gcctgggtgt attggccagg agaggacaca gaggaagagg aagatgagga agaagatgag gacagtgact ctggatcaga tgaggaagag ggagaagctg aggcttcctc ttccactcct gctacaggtg tcttcttgaa gtcctgggtc tatcagccag gagaggacac agaggaggag gaagatgagg acagtgatac aggatcagcc gaggatgaaa gagaagctga gacttctgct tccacacccc ctgcaagtgc tttcttgaag gcctgggtgt atcggccagg agaggacacg gaggaggagg aagatgagga tgtggatagt gaggataagg aagatgattc agaagcagcc ttgggagaag ctgagtcaga cccacatccc tcccacccgg accagagggc ccacttcagg ggctggggat atcgacctgg aaaagagaca gaggaagagg aagctgctga ggactgggga gaagctgagc cctgcccctt ccgagtggcc atctatgtac ctggagagaa gccaccgcct ccctgggctc ctcctaggct gcccctccga ctgcaaaggc ggctcaagcg cccagaaacc cctactcatg atccggaccc tgagactccc ctaaaggcca gaaaggtgcg cttctccgag aaggtcactg tccatttcct ggctgtctgg gcagggccgg cccaggccgc ccgccagggc ccctgggagc agcttgctcg ggatcgcagc cgcttcgcac gccgcatcac ccaggcccag gaggagctga gcccctgcct cacccctgct gcccgggcca gagcctgggc acgcctcagg aacccacctt tagcccccat ccctgccctc acccagacct tgccttcctc ctctgtccct tcgtccccag tccagaccac gcccttgagc caagctgtgg ccacaccttc ccgctcgtct gctgctgcag cggctgccct ggacctcagt gggaggcgtg gctga. It is sometimes possible for the material contained within the vial of "PPP1R15A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.