Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPIF cdna clone

PPIF cDNA Clone

Gene Names
PPIF; CYP3; CypD; CyP-M; Cyp-D
Synonyms
PPIF; PPIF cDNA Clone; PPIF cdna clone
Ordering
For Research Use Only!
Sequence
atgctggcgctgcgctgcggctcccgctggctcggcctgctctccgtcccgcgctccgtgccgctgcgcctccccgcggcccgcgcctgcagcaagggctccggcgacccgtcctcttcctcctcctccgggaacccgctcgtgtacctggacgtggacgccaacgggaagccgctcggccgcgtggtgctggagctgaaggcagatgtcgtcccaaagacagctgagaacttcagagccctgtgcactggtgagaagggcttcggctacaaaggctccaccttccacagggtgatcccttccttcatgtgccaggcgggcgacttcaccaaccacaatggcacaggcgggaagtccatctacggaagccgctttcctgacgagaactttacactgaagcacgtggggccaggtgtcctgtccatggctaatgctggtcctaacaccaacggctcccagttcttcatctgcaccataaagacagactggttggatggcaagcatgttgtgttcggtcacgtcaaagagggcatggacgtcgtgaagaaaatagaatctttcggctctaagagtgggaggacatccaagaagattgtcatcacagactgtggccagttgagctaa
Sequence Length
624
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,541 Da
NCBI Official Full Name
Homo sapiens peptidylprolyl isomerase F, mRNA
NCBI Official Synonym Full Names
peptidylprolyl isomerase F
NCBI Official Symbol
PPIF
NCBI Official Synonym Symbols
CYP3; CypD; CyP-M; Cyp-D
NCBI Protein Information
peptidyl-prolyl cis-trans isomerase F, mitochondrial
UniProt Protein Name
Peptidyl-prolyl cis-trans isomerase F, mitochondrial
UniProt Gene Name
PPIF
UniProt Synonym Gene Names
CYP3; PPIase F; CyP-D; CypD; CyP-M
UniProt Entry Name
PPIF_HUMAN

NCBI Description

The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein is part of the mitochondrial permeability transition pore in the inner mitochondrial membrane. Activation of this pore is thought to be involved in the induction of apoptotic and necrotic cell death. [provided by RefSeq, Jul 2008]

Uniprot Description

PPIF: PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. Belongs to the cyclophilin-type PPIase family.

Protein type: Cyclophilin; EC 5.2.1.8; Mitochondrial; Isomerase

Chromosomal Location of Human Ortholog: 10q22.3

Cellular Component: membrane; mitochondrial matrix; mitochondrial proton-transporting ATP synthase complex

Molecular Function: peptidyl-prolyl cis-trans isomerase activity; protein binding

Biological Process: negative regulation of apoptosis; negative regulation of ATPase activity; regulation of mitochondrial membrane permeability

Research Articles on PPIF

Similar Products

Product Notes

The PPIF ppif (Catalog #AAA1270184) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggcgc tgcgctgcgg ctcccgctgg ctcggcctgc tctccgtccc gcgctccgtg ccgctgcgcc tccccgcggc ccgcgcctgc agcaagggct ccggcgaccc gtcctcttcc tcctcctccg ggaacccgct cgtgtacctg gacgtggacg ccaacgggaa gccgctcggc cgcgtggtgc tggagctgaa ggcagatgtc gtcccaaaga cagctgagaa cttcagagcc ctgtgcactg gtgagaaggg cttcggctac aaaggctcca ccttccacag ggtgatccct tccttcatgt gccaggcggg cgacttcacc aaccacaatg gcacaggcgg gaagtccatc tacggaagcc gctttcctga cgagaacttt acactgaagc acgtggggcc aggtgtcctg tccatggcta atgctggtcc taacaccaac ggctcccagt tcttcatctg caccataaag acagactggt tggatggcaa gcatgttgtg ttcggtcacg tcaaagaggg catggacgtc gtgaagaaaa tagaatcttt cggctctaag agtgggagga catccaagaa gattgtcatc acagactgtg gccagttgag ctaa. It is sometimes possible for the material contained within the vial of "PPIF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.