Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPCDC cdna clone

PPCDC cDNA Clone

Gene Names
PPCDC; coaC; MDS018; PPC-DC
Synonyms
PPCDC; PPCDC cDNA Clone; PPCDC cdna clone
Ordering
For Research Use Only!
Sequence
atggaaccaaaggcctcctgtccagctgctgcacccttgatggagagaaaattccatgttcttgtgggtgtcacggggagtgtcgcagccctgaagttgcctcttctggtgtcaaagcttttggacattcctgggctggaagtagcagtggtcacaactgagagagccaaacatttctacagcccccaggacattcctgtcaccctctacagcgacgctgatgaatgggagatgtggaagagccgctctgacccagttctgcacattgacctgcggaggtgggcagacctcctgctggtggctcctcttgatgccaacactctggggaaggtggccagtggcatctgtgacaacttgcttacctgcgtcatgcgggcctgggaccgcagcaagcccctgctcttctgcccggccatgaacaccgccatgtgggagcacccgatcacagcgcagcaggtagaccagctcaaggcctttggctatgtcgagatcccctgtgtggccaagaagctggtgtgcggagatgaaggtctcggggccatggctgaagtggggaccatcgtggacaaagtgaaagaagtcctcttccagcacagtggcttccagcagagttga
Sequence Length
615
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,069 Da
NCBI Official Full Name
Homo sapiens phosphopantothenoylcysteine decarboxylase, mRNA
NCBI Official Synonym Full Names
phosphopantothenoylcysteine decarboxylase
NCBI Official Symbol
PPCDC
NCBI Official Synonym Symbols
coaC; MDS018; PPC-DC
NCBI Protein Information
phosphopantothenoylcysteine decarboxylase
UniProt Protein Name
Phosphopantothenoylcysteine decarboxylase
UniProt Gene Name
PPCDC
UniProt Synonym Gene Names
COAC; PPC-DC
UniProt Entry Name
COAC_HUMAN

NCBI Description

Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]

Uniprot Description

PPCDC: Necessary for the biosynthesis of coenzyme A. Catalyzes the decarboxylation of 4-phosphopantothenoylcysteine to form 4'- phosphopantotheine. Belongs to the HFCD (homooligomeric flavin containing Cys decarboxylase) superfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lyase; EC 4.1.1.36; Cofactor and Vitamin Metabolism - pantothenate and CoA biosynthesis

Chromosomal Location of Human Ortholog: 15q24.2

Cellular Component: cytosol

Molecular Function: identical protein binding; phosphopantothenoylcysteine decarboxylase activity; protein binding

Biological Process: coenzyme A biosynthetic process; coenzyme biosynthetic process

Similar Products

Product Notes

The PPCDC ppcdc (Catalog #AAA1267133) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaccaa aggcctcctg tccagctgct gcacccttga tggagagaaa attccatgtt cttgtgggtg tcacggggag tgtcgcagcc ctgaagttgc ctcttctggt gtcaaagctt ttggacattc ctgggctgga agtagcagtg gtcacaactg agagagccaa acatttctac agcccccagg acattcctgt caccctctac agcgacgctg atgaatggga gatgtggaag agccgctctg acccagttct gcacattgac ctgcggaggt gggcagacct cctgctggtg gctcctcttg atgccaacac tctggggaag gtggccagtg gcatctgtga caacttgctt acctgcgtca tgcgggcctg ggaccgcagc aagcccctgc tcttctgccc ggccatgaac accgccatgt gggagcaccc gatcacagcg cagcaggtag accagctcaa ggcctttggc tatgtcgaga tcccctgtgt ggccaagaag ctggtgtgcg gagatgaagg tctcggggcc atggctgaag tggggaccat cgtggacaaa gtgaaagaag tcctcttcca gcacagtggc ttccagcaga gttga. It is sometimes possible for the material contained within the vial of "PPCDC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.