Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POU2F2 cdna clone

POU2F2 cDNA Clone

Gene Names
POU2F2; OCT2; OTF2; Oct-2
Synonyms
POU2F2; POU2F2 cDNA Clone; POU2F2 cdna clone
Ordering
For Research Use Only!
Sequence
atggttcactccagcatgggggctccagaaataagaatgtctaagcccctggaggccgagaagcaaggtctggactccccatcagagcacacagacaccgaaagaaatggaccagacactaatcatcagaacccccaaaataagacctccccattctccgtgtccccaactggccccagtacaaagatcaaggctgaagaccccagtggcgattcagccccagcagcacccctgccccctcagccggcccagcctcatctgccccaggcccaactcatgttgacgggcagccagctagctggggacatacagcagctcctccagctccagcagctggtgcttgtgccaggccaccacctccagccacctgctcagttcctgctaccgcaggcccagcagagccagccaggcctgctaccgacaccaaatctattccagctacctcagcaaacccagggagctcttctgacctcccagccccgggccgggcttcccacacagccccccaaatgcttggagccaccatcccaccccgaggagcccagtgatctggaggagctggagcaattcgcccgcaccttcaagcaacgccgcatcaagctgggcttcacgcagggtgatgtgggcctggccatgggcaagctctacggcaacgacttcagccagacgaccatttcccgcttcgaggccctcaacctgagcttcaagaacatgtgcaaactcaagcccctcctggagaagtggctcaacgatgcagagactatgtctgtggactcaagcctgcccagccccaaccagctgagcagccccagcctgggtttcgacggcctgcccggccggagacgcaagaagaggaccagcatcgagacaaacgtccgcttcgccttagagaagagttttctagcgaaccagaagcctacctcagaggagatcctgctgatcgccgagcagctgcacatggagaaggaagtgatccgcgtctggttctgcaaccggcgccagaaggagaaacgcatcaacccctgcagtgcggcccccatgctgcccagcccagggaagccggccagctacagcccccatatggtcacaccccaagggggcgcggggaccttaccgttgtcccaagcttccagcagtctgagcacaacagcacaaaccccagccctcaaggcagccactcggctatcggcttgtcaggcctga
Sequence Length
1203
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,172 Da
NCBI Official Full Name
Homo sapiens POU class 2 homeobox 2, mRNA
NCBI Official Synonym Full Names
POU class 2 homeobox 2
NCBI Official Symbol
POU2F2
NCBI Official Synonym Symbols
OCT2; OTF2; Oct-2
NCBI Protein Information
POU domain, class 2, transcription factor 2
UniProt Protein Name
POU domain, class 2, transcription factor 2
UniProt Gene Name
POU2F2
UniProt Synonym Gene Names
OCT2; OTF2; Oct-2; OTF-2
UniProt Entry Name
PO2F2_HUMAN

NCBI Description

The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

Oct2: Transcription factor that specifically binds to the octamer motif (5'-ATTTGCAT-3'). Regulates transcription in a number of tissues in addition to activating immunoglobulin gene expression. Modulates transcription transactivation by NR3C1, AR and PGR. Isoform 5 activates the U2 small nuclear RNA (snRNA) promoter. Belongs to the POU transcription factor family. Class- 2 subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: sequence-specific DNA binding; transcription factor activity

Biological Process: humoral immune response; snRNA transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter

Research Articles on POU2F2

Similar Products

Product Notes

The POU2F2 pou2f2 (Catalog #AAA1265866) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttcact ccagcatggg ggctccagaa ataagaatgt ctaagcccct ggaggccgag aagcaaggtc tggactcccc atcagagcac acagacaccg aaagaaatgg accagacact aatcatcaga acccccaaaa taagacctcc ccattctccg tgtccccaac tggccccagt acaaagatca aggctgaaga ccccagtggc gattcagccc cagcagcacc cctgccccct cagccggccc agcctcatct gccccaggcc caactcatgt tgacgggcag ccagctagct ggggacatac agcagctcct ccagctccag cagctggtgc ttgtgccagg ccaccacctc cagccacctg ctcagttcct gctaccgcag gcccagcaga gccagccagg cctgctaccg acaccaaatc tattccagct acctcagcaa acccagggag ctcttctgac ctcccagccc cgggccgggc ttcccacaca gccccccaaa tgcttggagc caccatccca ccccgaggag cccagtgatc tggaggagct ggagcaattc gcccgcacct tcaagcaacg ccgcatcaag ctgggcttca cgcagggtga tgtgggcctg gccatgggca agctctacgg caacgacttc agccagacga ccatttcccg cttcgaggcc ctcaacctga gcttcaagaa catgtgcaaa ctcaagcccc tcctggagaa gtggctcaac gatgcagaga ctatgtctgt ggactcaagc ctgcccagcc ccaaccagct gagcagcccc agcctgggtt tcgacggcct gcccggccgg agacgcaaga agaggaccag catcgagaca aacgtccgct tcgccttaga gaagagtttt ctagcgaacc agaagcctac ctcagaggag atcctgctga tcgccgagca gctgcacatg gagaaggaag tgatccgcgt ctggttctgc aaccggcgcc agaaggagaa acgcatcaac ccctgcagtg cggcccccat gctgcccagc ccagggaagc cggccagcta cagcccccat atggtcacac cccaaggggg cgcggggacc ttaccgttgt cccaagcttc cagcagtctg agcacaacag cacaaacccc agccctcaag gcagccactc ggctatcggc ttgtcaggcc tga. It is sometimes possible for the material contained within the vial of "POU2F2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.