Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POU2F1 cdna clone

POU2F1 cDNA Clone

Gene Names
POU2F1; OCT1; OTF1; oct-1B
Synonyms
POU2F1; POU2F1 cDNA Clone; POU2F1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacaatccgtcagaaaccagtaaaccatctatggagagtggagatggcaacacaggcacacaaaccaatggtctggactttcagaagcagcctgtgcctgtaggaggagcaatctcaacagcccaggcgcaggctttccttggacatctccatcaggtccaactcgctggaacaagtttacaggctgctgctcagtctttaaatgtacagtctaaatctaatgaagaatcgggggattcgcagcagccaagccagccttcccagcagccttcagtgcaggcagccattccccagacccagcttatgctagctggaggacagataactgggcttactttgacgcctgcccagcaacagttactactccagcaggcacaggcacaggcacagctgctggctgctgcagtgcagcagcactccgccagccagcagcacagtgctgctggagccaccatctccgcctctgctgccacgcccatgacgcagatccccctgtctcagcccatacagatcgcacaggatcttcaacaactgcaacagcttcaacagcagaatctcaacctgcaacagtttgtgttggtgcatccaaccaccaatttgcagccagcgcagtttatcatctcacagacgccccagggccagcagggtctcctgcaagcgcaaaatcttctaacgcaactacctcagcaaagccaagccaacctcctacagtcgcagccaagcatcaccctcacctcccagccagcaaccccaacacgcacaatagcagcaaccccaattcagacacttccacagagccagtcaacaccaaagcgaattgatactcccagcttggaggagcccagtgaccttgaggagcttgagcagtttgccaagaccttcaaacaaagacgaatcaaacttggattcactcagggtgatgttgggctcgctatggggaaactatatggaaatgacttcagccaaactaccatctctcgatttgaagccttgaacctcagctttaagaacatgtgcaagttgaagccacttttagagaagtggctaaatgatgcagagaacctctcatctgattcgtccctctccagcccaagtgccctgaattctccaggaattgagggcttgagccgtaggaggaagaaacgcaccagcatagagaccaacatccgtgtggccttagagaagagtttcttggagaatcaaaagcctacctcggaagagatcactatgattgctgatcagctcaatatggaaaaagaggtgattcgtgtttggttctgtaaccgccgccagaaagaaaaaagaatcaacccaccaagcagtggtgggaccagcagctcacctattaaagcaattttccccagcccaacttcactggtggcgaccacaccaagccttgtgactagcagtgcagcaactaccctcacagtcagccctgtcctccctctgaccagtgctgctgtgacgaatctttcagttacaggcacttcagacaccacctccaacaacacagcaaccgtgatttccacagcgcctccagcttcctcagcagtcacgtccccctctctgagtccctccccttctgcctcagcctccacctccgaggcatccagtgccagtgagaccagcacaacacagaccacctccactcctttgtcctcccctcttgggaccagccaggtgatggtgacagcatcaggtttgcaaacagcagcagctgctgcccttcaaggagctgcacagttgccagcaaatgccagtcttgctgccatggcagctgctgcaggactaaacccaagcctgatggcaccctcacagtttgcggctggaggtgccttactcagtctgaatccagggaccctgagcggtgctctcagcccagctctaatgagcaacagtacactggcaactattcaagctcttgcttctggtggctctcttccaataacatcacttgatgcaactgggaacctggtatttgccaatgcgggaggagcccccaacatcgtgactgcccctctgttcctgaaccctcagaacctctctctgctcaccagcaaccctgttagcttggtctctgccgccgcagcatctgcagggaactctgcacctgtagccagccttcacgccacctccacctctgctgagtccatccagaactctctcttcacagtggcctctgccagcggggctgcgtccaccaccaccaccgcctccaaggcacagtga
Sequence Length
2232
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,082 Da
NCBI Official Full Name
Homo sapiens POU class 2 homeobox 1, mRNA
NCBI Official Synonym Full Names
POU class 2 homeobox 1
NCBI Official Symbol
POU2F1
NCBI Official Synonym Symbols
OCT1; OTF1; oct-1B
NCBI Protein Information
POU domain, class 2, transcription factor 1
UniProt Protein Name
POU domain, class 2, transcription factor 1
UniProt Gene Name
POU2F1
UniProt Synonym Gene Names
OCT1; OTF1; Oct-1; OTF-1
UniProt Entry Name
PO2F1_HUMAN

NCBI Description

The OCT1 transcription factor was among the first identified members of the POU transcription factor family (summarized by Sturm et al., 1993 [PubMed 8314572]). Members of this family contain the POU domain, a 160-amino acid region necessary for DNA binding to the octameric sequence ATGCAAAT.[supplied by OMIM, Jul 2010]

Uniprot Description

Oct1: a ubiquitous transcription factor that binds to the octamer motif (5'-ATTTGCAT-3') and activates the promoters of the genes for some small nuclear RNAs (snRNA) and of genes such as those for histone H2B and immunoglobulins. Modulates transcription transactivation by NR3C1, AR and PGR. Phosphorylation apparently inhibits its interaction with DNA. Four splice variant isoforms have been described. Isoform 2 is lymphocyte specific.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 1q24.2

Cellular Component: endoplasmic reticulum; intracellular membrane-bound organelle; nucleoplasm; nucleus

Molecular Function: protein binding; sequence-specific DNA binding

Biological Process: negative regulation of transcription, DNA-dependent; snRNA transcription from RNA polymerase II promoter

Research Articles on POU2F1

Similar Products

Product Notes

The POU2F1 pou2f1 (Catalog #AAA1278505) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacaatc cgtcagaaac cagtaaacca tctatggaga gtggagatgg caacacaggc acacaaacca atggtctgga ctttcagaag cagcctgtgc ctgtaggagg agcaatctca acagcccagg cgcaggcttt ccttggacat ctccatcagg tccaactcgc tggaacaagt ttacaggctg ctgctcagtc tttaaatgta cagtctaaat ctaatgaaga atcgggggat tcgcagcagc caagccagcc ttcccagcag ccttcagtgc aggcagccat tccccagacc cagcttatgc tagctggagg acagataact gggcttactt tgacgcctgc ccagcaacag ttactactcc agcaggcaca ggcacaggca cagctgctgg ctgctgcagt gcagcagcac tccgccagcc agcagcacag tgctgctgga gccaccatct ccgcctctgc tgccacgccc atgacgcaga tccccctgtc tcagcccata cagatcgcac aggatcttca acaactgcaa cagcttcaac agcagaatct caacctgcaa cagtttgtgt tggtgcatcc aaccaccaat ttgcagccag cgcagtttat catctcacag acgccccagg gccagcaggg tctcctgcaa gcgcaaaatc ttctaacgca actacctcag caaagccaag ccaacctcct acagtcgcag ccaagcatca ccctcacctc ccagccagca accccaacac gcacaatagc agcaacccca attcagacac ttccacagag ccagtcaaca ccaaagcgaa ttgatactcc cagcttggag gagcccagtg accttgagga gcttgagcag tttgccaaga ccttcaaaca aagacgaatc aaacttggat tcactcaggg tgatgttggg ctcgctatgg ggaaactata tggaaatgac ttcagccaaa ctaccatctc tcgatttgaa gccttgaacc tcagctttaa gaacatgtgc aagttgaagc cacttttaga gaagtggcta aatgatgcag agaacctctc atctgattcg tccctctcca gcccaagtgc cctgaattct ccaggaattg agggcttgag ccgtaggagg aagaaacgca ccagcataga gaccaacatc cgtgtggcct tagagaagag tttcttggag aatcaaaagc ctacctcgga agagatcact atgattgctg atcagctcaa tatggaaaaa gaggtgattc gtgtttggtt ctgtaaccgc cgccagaaag aaaaaagaat caacccacca agcagtggtg ggaccagcag ctcacctatt aaagcaattt tccccagccc aacttcactg gtggcgacca caccaagcct tgtgactagc agtgcagcaa ctaccctcac agtcagccct gtcctccctc tgaccagtgc tgctgtgacg aatctttcag ttacaggcac ttcagacacc acctccaaca acacagcaac cgtgatttcc acagcgcctc cagcttcctc agcagtcacg tccccctctc tgagtccctc cccttctgcc tcagcctcca cctccgaggc atccagtgcc agtgagacca gcacaacaca gaccacctcc actcctttgt cctcccctct tgggaccagc caggtgatgg tgacagcatc aggtttgcaa acagcagcag ctgctgccct tcaaggagct gcacagttgc cagcaaatgc cagtcttgct gccatggcag ctgctgcagg actaaaccca agcctgatgg caccctcaca gtttgcggct ggaggtgcct tactcagtct gaatccaggg accctgagcg gtgctctcag cccagctcta atgagcaaca gtacactggc aactattcaa gctcttgctt ctggtggctc tcttccaata acatcacttg atgcaactgg gaacctggta tttgccaatg cgggaggagc ccccaacatc gtgactgccc ctctgttcct gaaccctcag aacctctctc tgctcaccag caaccctgtt agcttggtct ctgccgccgc agcatctgca gggaactctg cacctgtagc cagccttcac gccacctcca cctctgctga gtccatccag aactctctct tcacagtggc ctctgccagc ggggctgcgt ccaccaccac caccgcctcc aaggcacagt ga. It is sometimes possible for the material contained within the vial of "POU2F1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.