POU2AF1 cdna clone
POU2AF1 cDNA Clone
Gene Names
POU2AF1; BOB1; OBF1; OCAB; OBF-1
Synonyms
POU2AF1; POU2AF1 cDNA Clone; POU2AF1 cdna clone
Sequence
atgctctggcaaaaacccacagctccggagcaagccccagccccggcccggccataccagggcgtccgtgtgaaggagccagtgaaggaactgctgaggaggaagcgaggccacgccagcagtggggcagcacctgcacctacggcggtggtgctgccccatcagcccctggcgacctacaccacagtgggtccttcctgcctggacatggaaggttctgtgtctgcagtgacagaggaggctgccctgtgtgccggctggctctcccagcccaccccggccaccctgcagcccctggccccatggacaccttacaccgagtatgtgccccatgaagctgtcagctgcccctactcagctgacatgtatgtgcagcccgtgtgccccagctacacggtggtggggccctcctcagtgttgacctatgcctctccgccactcatcaccaatgtcacgacaagaagctccgccacgcccgcagtggggcccccgctggagggcccagagcaccaggcacccctcacctatttcccgtggcctcagcccctttccacactacccacctccaccctgcagtaccagcctccggccccagccctacctgggccccagtttgtccagctccccatctctatcccagagccagtccttcaggacatggaagaccccagaagagccgccagctcgttgaccatcgacaagctgcttttggaggaagaggatagcgacgcctatgcgcttaaccacactctctctgtggaaggcttttag
Sequence Length
771
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,436 Da
NCBI Official Full Name
Homo sapiens POU class 2 associating factor 1, mRNA
NCBI Official Synonym Full Names
POU class 2 associating factor 1
NCBI Official Symbol
POU2AF1
NCBI Official Synonym Symbols
BOB1; OBF1; OCAB; OBF-1
NCBI Protein Information
POU domain class 2-associating factor 1
UniProt Protein Name
POU domain class 2-associating factor 1
Protein Family
UniProt Gene Name
POU2AF1
UniProt Synonym Gene Names
OBF1
UniProt Entry Name
OBF1_HUMAN
Uniprot Description
POU2AF1: Transcriptional coactivator that specifically associates with either OCT1 or OCT2. It boosts the OCT1 mediated promoter activity and to a lesser extent, that of OCT2. It has no intrinsic DNA-binding activity. It recognizes the POU domains of OCT1 and OCT2. It is essential for the response of B-cells to antigens and required for the formation of germinal centers. A chromosomal aberration involving POU2AF1/OBF1 may be a cause of a form of B-cell leukemia. Translocation t(3;11)(q27;q23) with BCL6. Belongs to the POU2AF1 family.
Protein type: Oncoprotein; Transcription, coactivator/corepressor
Chromosomal Location of Human Ortholog: 11q23.1
Molecular Function: protein binding; transcription coactivator activity; transcription cofactor activity
Biological Process: humoral immune response; transcription from RNA polymerase II promoter
Research Articles on POU2AF1
Similar Products
Product Notes
The POU2AF1 pou2af1 (Catalog #AAA1266400) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctctggc aaaaacccac agctccggag caagccccag ccccggcccg gccataccag ggcgtccgtg tgaaggagcc agtgaaggaa ctgctgagga ggaagcgagg ccacgccagc agtggggcag cacctgcacc tacggcggtg gtgctgcccc atcagcccct ggcgacctac accacagtgg gtccttcctg cctggacatg gaaggttctg tgtctgcagt gacagaggag gctgccctgt gtgccggctg gctctcccag cccaccccgg ccaccctgca gcccctggcc ccatggacac cttacaccga gtatgtgccc catgaagctg tcagctgccc ctactcagct gacatgtatg tgcagcccgt gtgccccagc tacacggtgg tggggccctc ctcagtgttg acctatgcct ctccgccact catcaccaat gtcacgacaa gaagctccgc cacgcccgca gtggggcccc cgctggaggg cccagagcac caggcacccc tcacctattt cccgtggcct cagccccttt ccacactacc cacctccacc ctgcagtacc agcctccggc cccagcccta cctgggcccc agtttgtcca gctccccatc tctatcccag agccagtcct tcaggacatg gaagacccca gaagagccgc cagctcgttg accatcgaca agctgctttt ggaggaagag gatagcgacg cctatgcgct taaccacact ctctctgtgg aaggctttta g. It is sometimes possible for the material contained within the vial of "POU2AF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
