Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Test Data

PORCN cdna clone

PORCN cDNA Clone

Gene Names
PORCN; PPN; DHOF; FODH; MG61; PORC
Synonyms
PORCN; PORCN cDNA Clone; PORCN cdna clone
Ordering
For Research Use Only!
Sequence
atggccacctttagccgccaggaatttttccagcagctactgcaaggctgtctcctgcctactgcccagcagggccttgaccagatctggctgctccttgccatctgcctcgcctgccgcctcctctggaggctcgggttgccatcctacctgaagcatgcaagcaccgtggcaggcgggttcttcagcctctaccacttcttccagctgcacatggtttgggtcgtgctgctcagcctcctgtgctacctcgtgctgttcctctgccgacattcctcccatcgaggcgtcttcctatccgtcaccatcctcatctacctactcatgggtgagatgcacatggtagacaccgtgacatggcacaagatgcgaggggcacagatgattgtggccatgaaggcagtgtctctgggcttcgacctggaccggggcgaggtgggtacggtgccctcgccagtggagttcatgggctacctctacttcgtgggcaccatcgtcttcgggccctggatatccttccacagctacctacaagctgtccaaggccgcccactgagctgccggtggctgcagaaggtggcccggagcctggcactggccctgctgtgccttgtgctgtccacttgcgtgggcccctacctcttcccgtacttcatccccctcaacggtgaccgcctccttcgcaacaagaaacgcaaagccaggtggctgcgagcctacgagagtgctgtctccttccacttcagcaactattttgtgggctttctttccgaggccacggccacgttggcgggggctggctttaccgaggagaaggatcacctggaatgggacctgacggtgtccaagccactgaatgtggagctgcctcggtcaatggtggaagttgtcacaagctggaacctgcccatgtcttattggctaaataactatgttttcaagaatgctctccgcctggggaccttctcggctgtgctggtcacctatgcagccagcgccctcctacatggcttcagtttccacctggctgcggtcctgctgtccctggcttttatcacttacgtggagcatgtcctccggaagcgcctggctcggatcctcagtgcctgtgtcttgtcaaagcggtgcccgccagactgttcgcaccagcatcgcttgggcctgggggtgcgagccttaaacttgctctttggagctctggccatcttccacctggcctacctgggctccctgtttgatgtcgatgtggatgacaccacagaggagcagggctacggcatggcatacactgtccacaagtggtcagagctcagctgggccagtcactgggtcacttttggatgctggatcttctaccgtctcataggctga
Sequence Length
1371
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

Test Data

Test Data

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,878 Da
NCBI Official Full Name
Homo sapiens porcupine homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
porcupine homolog (Drosophila)
NCBI Official Symbol
PORCN
NCBI Official Synonym Symbols
PPN; DHOF; FODH; MG61; PORC
NCBI Protein Information
protein-serine O-palmitoleoyltransferase porcupine
UniProt Protein Name
Protein-serine O-palmitoleoyltransferase porcupine
UniProt Gene Name
PORCN
UniProt Entry Name
PORCN_HUMAN

NCBI Description

This gene belongs to the evolutionarily conserved porcupine (Porc) gene family. Genes of the porcupine family encode endoplasmic reticulum proteins with multiple transmembrane domains. Porcupine proteins are involved in the processing of Wnt (wingless and int homologue) proteins. Disruption of this gene is associated with focal dermal hypoplasia, and the encoded protein has been implicated in cancer. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2013]

Uniprot Description

PORCN: protein-cysteine N-palmitoyltransferase that modulates the processing of Wnt proteins by mediating serine palmitoylation of Wnt family members. Defects in PORCN are the cause of focal dermal hypoplasia (FODH); also known as Goltz Gorlin syndrome. A rare congenital ectomesodermal disorder characterized by a combination of skin defects, skeletal abnormalities, and ocular anomalies. Affected individuals have patchy dermal hypoplasia, often in a distribution pattern following the Blaschko lines, and areas of subcutaneous fat herniation or deposition of fat into the dermis. In addition, sparse and brittle hair, hypoplastic nails and papillomas have been described. Skeletal abnormalities usually comprise syndactyly, ectrodactyly, and brachydactyly, and in some cases osteopathia striata has been seen. Patients frequently have ocular anomalies, including microphthalmia/ anophthalmia, coloboma, pigmentary and vascularization defects of the retina. Dental abnormalities are often present. Belongs to the membrane-bound acyltransferase family. Porcupine subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Transferase; EC 2.3.1.-; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: Xp11.23

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane

Biological Process: protein amino acid lipidation; protein palmitoleylation; Wnt receptor signaling pathway

Disease: Focal Dermal Hypoplasia

Research Articles on PORCN

Similar Products

Product Notes

The PORCN porcn (Catalog #AAA1269927) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacct ttagccgcca ggaatttttc cagcagctac tgcaaggctg tctcctgcct actgcccagc agggccttga ccagatctgg ctgctccttg ccatctgcct cgcctgccgc ctcctctgga ggctcgggtt gccatcctac ctgaagcatg caagcaccgt ggcaggcggg ttcttcagcc tctaccactt cttccagctg cacatggttt gggtcgtgct gctcagcctc ctgtgctacc tcgtgctgtt cctctgccga cattcctccc atcgaggcgt cttcctatcc gtcaccatcc tcatctacct actcatgggt gagatgcaca tggtagacac cgtgacatgg cacaagatgc gaggggcaca gatgattgtg gccatgaagg cagtgtctct gggcttcgac ctggaccggg gcgaggtggg tacggtgccc tcgccagtgg agttcatggg ctacctctac ttcgtgggca ccatcgtctt cgggccctgg atatccttcc acagctacct acaagctgtc caaggccgcc cactgagctg ccggtggctg cagaaggtgg cccggagcct ggcactggcc ctgctgtgcc ttgtgctgtc cacttgcgtg ggcccctacc tcttcccgta cttcatcccc ctcaacggtg accgcctcct tcgcaacaag aaacgcaaag ccaggtggct gcgagcctac gagagtgctg tctccttcca cttcagcaac tattttgtgg gctttctttc cgaggccacg gccacgttgg cgggggctgg ctttaccgag gagaaggatc acctggaatg ggacctgacg gtgtccaagc cactgaatgt ggagctgcct cggtcaatgg tggaagttgt cacaagctgg aacctgccca tgtcttattg gctaaataac tatgttttca agaatgctct ccgcctgggg accttctcgg ctgtgctggt cacctatgca gccagcgccc tcctacatgg cttcagtttc cacctggctg cggtcctgct gtccctggct tttatcactt acgtggagca tgtcctccgg aagcgcctgg ctcggatcct cagtgcctgt gtcttgtcaa agcggtgccc gccagactgt tcgcaccagc atcgcttggg cctgggggtg cgagccttaa acttgctctt tggagctctg gccatcttcc acctggccta cctgggctcc ctgtttgatg tcgatgtgga tgacaccaca gaggagcagg gctacggcat ggcatacact gtccacaagt ggtcagagct cagctgggcc agtcactggg tcacttttgg atgctggatc ttctaccgtc tcataggctg a. It is sometimes possible for the material contained within the vial of "PORCN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.