POPDC3 cdna clone
POPDC3 cDNA Clone
Gene Names
POPDC3; POP3; bA355M14.1
Synonyms
POPDC3; POPDC3 cDNA Clone; POPDC3 cdna clone
Sequence
atggaaagaaattcaagtttatggaagaacctaatagatgaacacccagtctgcacaacctggaagcaagaggccgaaggagccatttatcatcttgccagtattttatttgtagtaggtttcatgggtggcagtggattcttcgggctcctttatgtcttcagtttgctggggttgggttttctctgttctgctgtctgggcttgggtagatgtctgtgcagctgacatattttcctggaattttgtactgtttgtcatctgcttcatgcaatttgttcatattgcatatcaagttcgcagcataacctttgcccgagaattccaagtgttgtacagctcccttttccagcccctggggatctctttgcctgtcttcagaacgattgctttgagctctgaagtggttactttggaaaaggaacactgttatgccatgcaggggaaaacttccattgataaactctccttgcttgtttcaggaaggatcagagtgacagttgatggcgaatttctgcattacattttcccccttcagttcctggattctcctgagtgggattcactgagacccacagaggaaggcatttttcaggtaaccctcactgcagaaactgattgtcgatatgtgtcttggaggagaaagaaattatatctgctctttgctcagcatcgctacatctcccgccttttttcagtgctaattggcagtgacattgcagataaactctatgccttgaatgacagggtatatataggaaaaagatatcactatgatattcggctacccaacttctatcaaatgtcaactccagaaatacgcagatcacccctgacacaacattttcagaattccagacgatactgtgataaatga
Sequence Length
876
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,870 Da
NCBI Official Full Name
Homo sapiens popeye domain containing 3, mRNA
NCBI Official Synonym Full Names
popeye domain containing 3
NCBI Official Symbol
POPDC3
NCBI Official Synonym Symbols
POP3; bA355M14.1
NCBI Protein Information
popeye domain-containing protein 3
UniProt Protein Name
Popeye domain-containing protein 3
Protein Family
UniProt Gene Name
POPDC3
UniProt Synonym Gene Names
POP3; Popeye protein 3
UniProt Entry Name
POPD3_HUMAN
NCBI Description
This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in these tissues during development. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2008]
Uniprot Description
POPDC3: May play an important role in heart development. Belongs to the popeye family.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 6q21
Molecular Function: cAMP binding
Biological Process: regulation of membrane potential
Research Articles on POPDC3
Similar Products
Product Notes
The POPDC3 popdc3 (Catalog #AAA1275523) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaagaa attcaagttt atggaagaac ctaatagatg aacacccagt ctgcacaacc tggaagcaag aggccgaagg agccatttat catcttgcca gtattttatt tgtagtaggt ttcatgggtg gcagtggatt cttcgggctc ctttatgtct tcagtttgct ggggttgggt tttctctgtt ctgctgtctg ggcttgggta gatgtctgtg cagctgacat attttcctgg aattttgtac tgtttgtcat ctgcttcatg caatttgttc atattgcata tcaagttcgc agcataacct ttgcccgaga attccaagtg ttgtacagct cccttttcca gcccctgggg atctctttgc ctgtcttcag aacgattgct ttgagctctg aagtggttac tttggaaaag gaacactgtt atgccatgca ggggaaaact tccattgata aactctcctt gcttgtttca ggaaggatca gagtgacagt tgatggcgaa tttctgcatt acattttccc ccttcagttc ctggattctc ctgagtggga ttcactgaga cccacagagg aaggcatttt tcaggtaacc ctcactgcag aaactgattg tcgatatgtg tcttggagga gaaagaaatt atatctgctc tttgctcagc atcgctacat ctcccgcctt ttttcagtgc taattggcag tgacattgca gataaactct atgccttgaa tgacagggta tatataggaa aaagatatca ctatgatatt cggctaccca acttctatca aatgtcaact ccagaaatac gcagatcacc cctgacacaa cattttcaga attccagacg atactgtgat aaatga. It is sometimes possible for the material contained within the vial of "POPDC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
