Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POLR2K cdna clone

POLR2K cDNA Clone

Gene Names
POLR2K; RPB12; RPABC4; RPB7.0; hRPB7.0; hsRPB10a; RPB10alpha; ABC10-alpha
Synonyms
POLR2K; POLR2K cDNA Clone; POLR2K cdna clone
Ordering
For Research Use Only!
Sequence
atggacacccagaaggacgttcaacctccaaagcagcaaccaatgatatatatctgtggagagtgtcacacagaaaatgaaataaaatctagggatccaatcagatgcagagaatgtggatacagaataatgtacaagaaaaggactaaaagattggtcgtttttgatgctcgatga
Sequence Length
177
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,004 Da
NCBI Official Full Name
Homo sapiens polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa, mRNA
NCBI Official Synonym Full Names
RNA polymerase II subunit K
NCBI Official Symbol
POLR2K
NCBI Official Synonym Symbols
RPB12; RPABC4; RPB7.0; hRPB7.0; hsRPB10a; RPB10alpha; ABC10-alpha
NCBI Protein Information
DNA-directed RNA polymerases I, II, and III subunit RPABC4
UniProt Protein Name
DNA-directed RNA polymerases I, II, and III subunit RPABC4
UniProt Gene Name
POLR2K
UniProt Synonym Gene Names
RNA polymerases I, II, and III subunit ABC4; RPB7.0
UniProt Entry Name
RPAB4_HUMAN

NCBI Description

This gene encodes one of the smallest subunits of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases. [provided by RefSeq, Jul 2008]

Uniprot Description

POLR2K: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common component of RNA polymerases I, II and III which synthesize ribosomal RNA precursors, mRNA precursors and many functional non-coding RNAs, and a small RNAs, such as 5S rRNA and tRNAs, respectively. Belongs to the archaeal RpoP/eukaryotic RPC10 RNA polymerase subunit family.

Protein type: DNA repair, damage; RNA processing

Chromosomal Location of Human Ortholog: 8q22.2

Cellular Component: cytosol; DNA-directed RNA polymerase I complex; DNA-directed RNA polymerase II, core complex; DNA-directed RNA polymerase III complex; nucleoplasm; nucleus

Molecular Function: zinc ion binding

Biological Process: fibroblast growth factor receptor signaling pathway; gene expression; mRNA capping; nuclear mRNA splicing, via spliceosome; positive regulation of gene expression, epigenetic; positive regulation of interferon type I production; positive regulation of viral transcription; regulation of transcription from RNA polymerase I promoter; RNA elongation from RNA polymerase I promoter; RNA elongation from RNA polymerase II promoter; RNA-mediated gene silencing; snRNA transcription from RNA polymerase II promoter; somatic stem cell maintenance; termination of RNA polymerase I transcription; transcription from RNA polymerase II promoter; transcription from RNA polymerase III promoter; transcription initiation from RNA polymerase I promoter; transcription initiation from RNA polymerase II promoter; transcription-coupled nucleotide-excision repair

Research Articles on POLR2K

Similar Products

Product Notes

The POLR2K polr2k (Catalog #AAA1271511) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaccc agaaggacgt tcaacctcca aagcagcaac caatgatata tatctgtgga gagtgtcaca cagaaaatga aataaaatct agggatccaa tcagatgcag agaatgtgga tacagaataa tgtacaagaa aaggactaaa agattggtcg tttttgatgc tcgatga. It is sometimes possible for the material contained within the vial of "POLR2K, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.