POLM cdna clone
POLM cDNA Clone
Gene Names
POLM; Tdt-N; Pol Mu
Synonyms
POLM; POLM cDNA Clone; POLM cdna clone
Sequence
atgctccccaaacggcggcgagcgcgggtcgggtcccctagcggcgatgccgcttcctccacgccgccctcgacgcgcttcccgggagtcgccatctacctggtcgagcctcgcatgggtcgcagccgccgggccttcctcacaggcctggcgcgctccaaaggcttccgcgtccttgacgcctgcagctccgaagcgacacatgttgtgatggaagagacctcagcagaggaggccgtcagctggcaggagcgcaggatggcagctgctcccccgggttgcacccccccagctctgctggacataagctggttaacagagagcctgggagctgggcagcctgtacctgtggagtgccggcaccgcctggaggtggctgggccaaggaaggggcctctgagcccagcatggatgcctgcctatgcctgccagcgccctacgcccctcacacaccacaacactggcctctccgaggctctggagatactggccgaggcagcaggctttgaaggcagtgagggccgcctcctcaccttctgcagagcagcctcggtgctcaaggcccttcccagccctgtcacaaccctgagccagctgcaggggcttccccactttggagaacactcctctagggttgtccaggagctgctggagcatggagtgtgtgaggaggtggagagagttcggcgctcagagaggtaccagaccatgaaggtgcgcagggcagggctcggacctaccccaggaatgtcctgccctgggaatgacaacacagtccacaccatgcacggggaggcaaacaggggcagctga
Sequence Length
813
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,070 Da
NCBI Official Full Name
Homo sapiens polymerase (DNA directed), mu, mRNA
NCBI Official Synonym Full Names
DNA polymerase mu
NCBI Official Symbol
POLM
NCBI Official Synonym Symbols
Tdt-N; Pol Mu
NCBI Protein Information
DNA-directed DNA/RNA polymerase mu
UniProt Protein Name
DNA-directed DNA/RNA polymerase mu
Protein Family
UniProt Gene Name
POLM
UniProt Synonym Gene Names
polmu; Pol Mu
UniProt Entry Name
DPOLM_HUMAN
Uniprot Description
POLM: Gap-filling polymerase involved in repair of DNA double- strand breaks by non-homologous end joining (NHEJ). Participates in immunoglobulin (Ig) light chain gene rearrangement in V(D)J recombination. Belongs to the DNA polymerase type-X family.
Protein type: Transferase; DNA repair, damage; EC 2.7.7.7
Chromosomal Location of Human Ortholog: 7p13
Cellular Component: nucleoplasm
Molecular Function: DNA-directed DNA polymerase activity; protein binding
Biological Process: double-strand break repair via nonhomologous end joining
Research Articles on POLM
Similar Products
Product Notes
The POLM polm (Catalog #AAA1271924) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcccca aacggcggcg agcgcgggtc gggtccccta gcggcgatgc cgcttcctcc acgccgccct cgacgcgctt cccgggagtc gccatctacc tggtcgagcc tcgcatgggt cgcagccgcc gggccttcct cacaggcctg gcgcgctcca aaggcttccg cgtccttgac gcctgcagct ccgaagcgac acatgttgtg atggaagaga cctcagcaga ggaggccgtc agctggcagg agcgcaggat ggcagctgct cccccgggtt gcaccccccc agctctgctg gacataagct ggttaacaga gagcctggga gctgggcagc ctgtacctgt ggagtgccgg caccgcctgg aggtggctgg gccaaggaag gggcctctga gcccagcatg gatgcctgcc tatgcctgcc agcgccctac gcccctcaca caccacaaca ctggcctctc cgaggctctg gagatactgg ccgaggcagc aggctttgaa ggcagtgagg gccgcctcct caccttctgc agagcagcct cggtgctcaa ggcccttccc agccctgtca caaccctgag ccagctgcag gggcttcccc actttggaga acactcctct agggttgtcc aggagctgct ggagcatgga gtgtgtgagg aggtggagag agttcggcgc tcagagaggt accagaccat gaaggtgcgc agggcagggc tcggacctac cccaggaatg tcctgccctg ggaatgacaa cacagtccac accatgcacg gggaggcaaa caggggcagc tga. It is sometimes possible for the material contained within the vial of "POLM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
