Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PNLIPRP2 cdna clone

PNLIPRP2 cDNA Clone

Gene Names
PNLIPRP2; PLRP2
Synonyms
PNLIPRP2; PNLIPRP2 cDNA Clone; PNLIPRP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcccccttggaccctcggccttctcctgctggccacagtcagaggaaaagaggtctgctacggacaacttggctgcttttctgatgaaaaaccatgggcaggaacccttcagcgacctgtaaaattacttccctggtcccccgaggacattgacacccgctttcttctgtacacaaatgaaaatccaaacaacttccaactaatcactggcacggaaccagacaccattgaggcttcaaacttccaactggaccgcaagacacgcttcatcatccatggcttcttagacaaggcggaggacagctggccatcggacatgtgcaagaaaatgtttgaagtggagaaggtgaactgcatctgtgtggactggaggcacgggtcccgggcaatgtacacccaagccgtgcaaaacattcgggttgttggggcggagacagctttcttaatacaagcactgtcgacgcagctggggtacagccttgaggacgtgcatgtcatcggccacagcctgggcgcgcacacggccgcggaggcgggcaggaggctggggggccgcgtgggcaggatcacagggctggatccagcagggccgtgcttccaggatgaacctgaggaggttcggttggatccatctgacgccgtgtttgtggatgtgattcacacagattcttctcccatagttccttccctaggtttcggaatgagccaaaaggtgggccatctggatttctttccaaatggaggaaaggaaatgcccggatgtaagaaaaatgtcctttcaaccattactgatattgatggaatatgggaaggaattggtggctttgtgtcttgcaatcacctaagaagcttcgagtattactcaagcagcgtcctcaaccctgatggcttcctgggctatccctgtgcctcctacgatgagtttcaggagagtaagtgtttcccttgtccagctgaaggatgccccaaaatggggcactatgctgaccaatttaaggggaaaacaagtgctgtggaacaaacctttttcctgaacacaggagagagtggtaactttactagttggagatataaggtatcagtcacactttctggaaaagagaaagtgaatgggtacatcaggattgctttgtatggaagtaatgaaaactcgaaacaatatgagattttcaaaggatccctcaaaccagatgcaagtcacacgtgtgctattgatgtggattttaatgttggaaaaatacagaaagttaaattcctctggaacaaacgtgggataaatctatctgagcccaaactgggggcttcccaaatcacagtgcaaagtggtgaagatgggactgagtataatttttgtagcagcgacactgtggaagaaaacgtcttgcaatctctttacccttgttaa
Sequence Length
1410
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,947 Da
NCBI Official Full Name
Homo sapiens pancreatic lipase-related protein 2, mRNA
NCBI Official Synonym Full Names
pancreatic lipase related protein 2 (gene/pseudogene)
NCBI Official Symbol
PNLIPRP2
NCBI Official Synonym Symbols
PLRP2
NCBI Protein Information
pancreatic lipase-related protein 2
UniProt Protein Name
Pancreatic lipase-related protein 2
UniProt Gene Name
PNLIPRP2
UniProt Synonym Gene Names
PL-RP2
UniProt Entry Name
LIPR2_HUMAN

NCBI Description

This gene encodes a lipase that hydrolyzes galactolipids, the main components of plant membrane lipids. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Aug 2015]

Uniprot Description

PNLIPRP2: Lipase with broad substrate specificity. Can hydrolyze both phospholipids and galactolipids. Acts preferentially on monoglycerides, phospholipids and galactolipids. Contributes to milk fat hydrolysis. Belongs to the AB hydrolase superfamily. Lipase family.

Protein type: Lipid Metabolism - glycerolipid; Secreted, signal peptide; Secreted; EC 3.1.1.26; EC 3.1.1.3; Lipase

Chromosomal Location of Human Ortholog: 10q25.3

Cellular Component: extracellular region; extracellular space

Molecular Function: acylglycerol lipase activity; calcium ion binding; galactolipase activity; phospholipase activity; triacylglycerol lipase activity

Biological Process: galactolipid catabolic process; lipid digestion; phospholipid catabolic process; triacylglycerol metabolic process

Research Articles on PNLIPRP2

Similar Products

Product Notes

The PNLIPRP2 pnliprp2 (Catalog #AAA1270790) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcccc cttggaccct cggccttctc ctgctggcca cagtcagagg aaaagaggtc tgctacggac aacttggctg cttttctgat gaaaaaccat gggcaggaac ccttcagcga cctgtaaaat tacttccctg gtcccccgag gacattgaca cccgctttct tctgtacaca aatgaaaatc caaacaactt ccaactaatc actggcacgg aaccagacac cattgaggct tcaaacttcc aactggaccg caagacacgc ttcatcatcc atggcttctt agacaaggcg gaggacagct ggccatcgga catgtgcaag aaaatgtttg aagtggagaa ggtgaactgc atctgtgtgg actggaggca cgggtcccgg gcaatgtaca cccaagccgt gcaaaacatt cgggttgttg gggcggagac agctttctta atacaagcac tgtcgacgca gctggggtac agccttgagg acgtgcatgt catcggccac agcctgggcg cgcacacggc cgcggaggcg ggcaggaggc tggggggccg cgtgggcagg atcacagggc tggatccagc agggccgtgc ttccaggatg aacctgagga ggttcggttg gatccatctg acgccgtgtt tgtggatgtg attcacacag attcttctcc catagttcct tccctaggtt tcggaatgag ccaaaaggtg ggccatctgg atttctttcc aaatggagga aaggaaatgc ccggatgtaa gaaaaatgtc ctttcaacca ttactgatat tgatggaata tgggaaggaa ttggtggctt tgtgtcttgc aatcacctaa gaagcttcga gtattactca agcagcgtcc tcaaccctga tggcttcctg ggctatccct gtgcctccta cgatgagttt caggagagta agtgtttccc ttgtccagct gaaggatgcc ccaaaatggg gcactatgct gaccaattta aggggaaaac aagtgctgtg gaacaaacct ttttcctgaa cacaggagag agtggtaact ttactagttg gagatataag gtatcagtca cactttctgg aaaagagaaa gtgaatgggt acatcaggat tgctttgtat ggaagtaatg aaaactcgaa acaatatgag attttcaaag gatccctcaa accagatgca agtcacacgt gtgctattga tgtggatttt aatgttggaa aaatacagaa agttaaattc ctctggaaca aacgtgggat aaatctatct gagcccaaac tgggggcttc ccaaatcaca gtgcaaagtg gtgaagatgg gactgagtat aatttttgta gcagcgacac tgtggaagaa aacgtcttgc aatctcttta cccttgttaa. It is sometimes possible for the material contained within the vial of "PNLIPRP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.