Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PNKP cdna clone

PNKP cDNA Clone

Gene Names
PNKP; PNK; AOA4; MCSZ; EIEE10
Synonyms
PNKP; PNKP cDNA Clone; PNKP cdna clone
Ordering
For Research Use Only!
Sequence
atgcaaatcctgactccacccctccaatcctcagtggagctggtcgcagatcctgagacccggacagtggcagtgaaacagctgggagttaacccctcaactaccgggacccaggagttgaagccggggttggagggctctctgggggtgggggacacactgtatttggtcaatggcctccacccactgaccctgcgctgggaagagacccgcacaccagaatcccagccagatactccgcctggcacccctctggtgtcccaagatgagaagagagatgctgagctgccgaagaagcgtatgcggaagtcaaaccccggctgggagaacttggagaagttgctagtgttcaccgcagctggggtgaaaccccagggcaaggtggctggctttgatctggacgggacgctcatcaccacacgctctgggaaggtctttcccactggccccagtgactggaggatcttgtacccagagattccccgtaagctccgagagctggaagccgagggctacaagctggtgatcttcaccaaccagatgagcatcgggcgcgggaagctgccagccgaggagttcaaggccaaggtggaggctgtggtggagaagctgggggtccccttccaggtgctggtggccacgcacgcaggcttgtaccggaagccggtgacgggcatgtgggaccatctgcaggagcaggccaacgacggcacgcccatatccatcggggacagcatctttgtgggagacgcagccggacgcccggccaactgggccccggggcggaagaagaaagacttctcctgcgccgatcgcctgtttgccctcaaccttggcctgcccttcgccacgcctgaggagttctttctcaagtggccagcagccggcttcgagctcccagcctttgatccgaggactgtctcccgctcagggcctctctgcctccccgagtccagggccctcctgagcgccagcccggaggtggttgtcgcagtgggattccctggggccgggaagtccacctttctcaagaagcacctcgtgtcggccggatatgtccacgtgaacagggacacgctaggctcctggcagcgctgtgtgaccacgtgtgagacagccctgaagcaagggaaacgggtcgccatcgacaacacaaacccagacgccgcgagccgcgccaggtacgtccagtgtgcccgagccgcgggcgtcccctgccgctgcttcctcttcaccgccactctggagcaggcgcgccacaacaaccggtttcgagagatgacggactcctctcatatccccgtgtcagacatggtcatgtatggctacaggaagcagttcgaggccccaacgctggctgaaggcttctctgccatcctggagatcccgttccggctatgggtggagccgaggctggggcggctgtactgccagttctccgagggctga
Sequence Length
1449
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,004 Da
NCBI Official Full Name
Homo sapiens polynucleotide kinase 3'-phosphatase, mRNA
NCBI Official Synonym Full Names
polynucleotide kinase 3'-phosphatase
NCBI Official Symbol
PNKP
NCBI Official Synonym Symbols
PNK; AOA4; MCSZ; EIEE10
NCBI Protein Information
bifunctional polynucleotide phosphatase/kinase
UniProt Protein Name
Bifunctional polynucleotide phosphatase/kinase
UniProt Gene Name
PNKP
UniProt Entry Name
PNKP_HUMAN

NCBI Description

This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]

Uniprot Description

Pnk1: polynucleotide kinase 3'-phosphatase. May be involved in double-strand break repair by non-homologous end joining. Required for normal response to DNA damage by gamma-radiation or camptothecin in S. pombe.

Protein type: Kinase, other; Phosphatase (non-protein); DNA-binding; EC 2.7.1.78; EC 3.1.3.32

Chromosomal Location of Human Ortholog: 19q13.3-q13.4

Cellular Component: membrane; nucleolus; nucleoplasm; nucleus

Molecular Function: ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity; double-stranded DNA binding; nucleotide kinase activity; polynucleotide 3'-phosphatase activity; protein binding

Biological Process: dephosphorylation; DNA damage response, detection of DNA damage; DNA repair; nucleotide phosphorylation; positive regulation of telomerase activity; positive regulation of telomere maintenance via telomerase; response to oxidative stress; response to radiation

Disease: Ataxia-oculomotor Apraxia 4; Microcephaly, Seizures, And Developmental Delay

Research Articles on PNKP

Similar Products

Product Notes

The PNKP pnkp (Catalog #AAA1276886) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaaatcc tgactccacc cctccaatcc tcagtggagc tggtcgcaga tcctgagacc cggacagtgg cagtgaaaca gctgggagtt aacccctcaa ctaccgggac ccaggagttg aagccggggt tggagggctc tctgggggtg ggggacacac tgtatttggt caatggcctc cacccactga ccctgcgctg ggaagagacc cgcacaccag aatcccagcc agatactccg cctggcaccc ctctggtgtc ccaagatgag aagagagatg ctgagctgcc gaagaagcgt atgcggaagt caaaccccgg ctgggagaac ttggagaagt tgctagtgtt caccgcagct ggggtgaaac cccagggcaa ggtggctggc tttgatctgg acgggacgct catcaccaca cgctctggga aggtctttcc cactggcccc agtgactgga ggatcttgta cccagagatt ccccgtaagc tccgagagct ggaagccgag ggctacaagc tggtgatctt caccaaccag atgagcatcg ggcgcgggaa gctgccagcc gaggagttca aggccaaggt ggaggctgtg gtggagaagc tgggggtccc cttccaggtg ctggtggcca cgcacgcagg cttgtaccgg aagccggtga cgggcatgtg ggaccatctg caggagcagg ccaacgacgg cacgcccata tccatcgggg acagcatctt tgtgggagac gcagccggac gcccggccaa ctgggccccg gggcggaaga agaaagactt ctcctgcgcc gatcgcctgt ttgccctcaa ccttggcctg cccttcgcca cgcctgagga gttctttctc aagtggccag cagccggctt cgagctccca gcctttgatc cgaggactgt ctcccgctca gggcctctct gcctccccga gtccagggcc ctcctgagcg ccagcccgga ggtggttgtc gcagtgggat tccctggggc cgggaagtcc acctttctca agaagcacct cgtgtcggcc ggatatgtcc acgtgaacag ggacacgcta ggctcctggc agcgctgtgt gaccacgtgt gagacagccc tgaagcaagg gaaacgggtc gccatcgaca acacaaaccc agacgccgcg agccgcgcca ggtacgtcca gtgtgcccga gccgcgggcg tcccctgccg ctgcttcctc ttcaccgcca ctctggagca ggcgcgccac aacaaccggt ttcgagagat gacggactcc tctcatatcc ccgtgtcaga catggtcatg tatggctaca ggaagcagtt cgaggcccca acgctggctg aaggcttctc tgccatcctg gagatcccgt tccggctatg ggtggagccg aggctggggc ggctgtactg ccagttctcc gagggctga. It is sometimes possible for the material contained within the vial of "PNKP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.