Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PNKP cdna clone

PNKP cDNA Clone

Gene Names
PNKP; PNK; AOA4; MCSZ; EIEE10
Synonyms
PNKP; PNKP cDNA Clone; PNKP cdna clone
Ordering
For Research Use Only!
Sequence
atgggcgaggtggaggccccgggccgcttgtggctcgagagcccccctgggggagcgccccccatcttcctgccctcggacgggcaagccctggtcctgggcaggggacccctgacccaggttacggaccggaagtgctccagaactcaagtggagctggtcgcagatcctgagacccggacagtggcagtgaaacagctgggagttaacccctcaactaccgggacccaggagttgaagccggggttggagggctctctgggggtgggggacacactgtatttggtcaatggcctccacccactgaccctgcgctgggaagagacccgcacaccagaatcccagccagatactccgcctggcacccctctggtgtcccaagatgagaagagagatgctgagctgccgaagaagcgtatgcggaagtcaaaccccggctgggagaacttggagaagttgctagtgttcaccgcagctggggtgaaaccccagggcaaggtggctggctttgatctggacgggacgctcatcaccacacgctctgggaaggtctttcccactggccccagtgactggaggatcttgtacccagagattccccgtaagctccgagagctggaagccgagggctacaagctggtgatcttcaccaaccagatgagcatcgggcgcgggaagctgccagccgaggagttcaaggccaaggtggaggctgtggtggagaagctgggggtccccttccaggtgctggtggccacgcacgcaggcttgtaccggaagccggtgacgggcatgtgggaccatctgcaggagcaggccaacgacggcacgcccatatccatcggggacagcatctttgtgggagacgcagccggacgcccggccaactgggccccggggcggaagaagaaagacttctcctgcgccgatcgcctgtttgccctcaaccttggcctgcccttcgccacgcctgaggagttctttctcaagtggccagcagccggcttcgagctcccagcctttgatccgaggactgtctcccgctcagggcctctctgcctccccgagtccagggccctcctgagcgccagcccggaggtggttgtcgcagtgggattccctggggccgggaagtccacctttctcaagaagcacctcgtgtcggccggatatgtccacgtgaacagggacacgctaggctcctggcagcgctgtgtgaccacgtgtgagacagccctgaagcaagggaaacgggtcgccatcgacaacacaaacccagacgccgcgagccgcgccaggtacgtccagtgtgcccgagccgcgggcgtcccctgccgctgcttcctcttcaccgccactctggagcaggcgcgccacaacaaccggtttcgagagatgacggactcctctcatatccccgtgtcagacatggtcatgtatggctacaggaagcagttcgaggccccaacgctggctgaaggcttctctgccatcctggagatcccgttccggctatgggtggagccgaggctggggcggctgtactgccagttctccgagggctga
Sequence Length
1566
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,004 Da
NCBI Official Full Name
Homo sapiens polynucleotide kinase 3'-phosphatase, mRNA
NCBI Official Synonym Full Names
polynucleotide kinase 3'-phosphatase
NCBI Official Symbol
PNKP
NCBI Official Synonym Symbols
PNK; AOA4; MCSZ; EIEE10
NCBI Protein Information
bifunctional polynucleotide phosphatase/kinase
UniProt Protein Name
Bifunctional polynucleotide phosphatase/kinase
UniProt Gene Name
PNKP
UniProt Entry Name
PNKP_HUMAN

NCBI Description

This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]

Uniprot Description

Pnk1: polynucleotide kinase 3'-phosphatase. May be involved in double-strand break repair by non-homologous end joining. Required for normal response to DNA damage by gamma-radiation or camptothecin in S. pombe.

Protein type: Phosphatase (non-protein); DNA-binding; Kinase, other; EC 3.1.3.32; EC 2.7.1.78

Chromosomal Location of Human Ortholog: 19q13.3-q13.4

Cellular Component: membrane; nucleolus; nucleoplasm; nucleus

Molecular Function: ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity; double-stranded DNA binding; nucleotide kinase activity; polynucleotide 3'-phosphatase activity; protein binding

Biological Process: dephosphorylation; DNA damage response, detection of DNA damage; DNA repair; nucleotide phosphorylation; positive regulation of telomerase activity; positive regulation of telomere maintenance via telomerase; response to oxidative stress; response to radiation

Disease: Ataxia-oculomotor Apraxia 4; Microcephaly, Seizures, And Developmental Delay

Research Articles on PNKP

Similar Products

Product Notes

The PNKP pnkp (Catalog #AAA1269975) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcgagg tggaggcccc gggccgcttg tggctcgaga gcccccctgg gggagcgccc cccatcttcc tgccctcgga cgggcaagcc ctggtcctgg gcaggggacc cctgacccag gttacggacc ggaagtgctc cagaactcaa gtggagctgg tcgcagatcc tgagacccgg acagtggcag tgaaacagct gggagttaac ccctcaacta ccgggaccca ggagttgaag ccggggttgg agggctctct gggggtgggg gacacactgt atttggtcaa tggcctccac ccactgaccc tgcgctggga agagacccgc acaccagaat cccagccaga tactccgcct ggcacccctc tggtgtccca agatgagaag agagatgctg agctgccgaa gaagcgtatg cggaagtcaa accccggctg ggagaacttg gagaagttgc tagtgttcac cgcagctggg gtgaaacccc agggcaaggt ggctggcttt gatctggacg ggacgctcat caccacacgc tctgggaagg tctttcccac tggccccagt gactggagga tcttgtaccc agagattccc cgtaagctcc gagagctgga agccgagggc tacaagctgg tgatcttcac caaccagatg agcatcgggc gcgggaagct gccagccgag gagttcaagg ccaaggtgga ggctgtggtg gagaagctgg gggtcccctt ccaggtgctg gtggccacgc acgcaggctt gtaccggaag ccggtgacgg gcatgtggga ccatctgcag gagcaggcca acgacggcac gcccatatcc atcggggaca gcatctttgt gggagacgca gccggacgcc cggccaactg ggccccgggg cggaagaaga aagacttctc ctgcgccgat cgcctgtttg ccctcaacct tggcctgccc ttcgccacgc ctgaggagtt ctttctcaag tggccagcag ccggcttcga gctcccagcc tttgatccga ggactgtctc ccgctcaggg cctctctgcc tccccgagtc cagggccctc ctgagcgcca gcccggaggt ggttgtcgca gtgggattcc ctggggccgg gaagtccacc tttctcaaga agcacctcgt gtcggccgga tatgtccacg tgaacaggga cacgctaggc tcctggcagc gctgtgtgac cacgtgtgag acagccctga agcaagggaa acgggtcgcc atcgacaaca caaacccaga cgccgcgagc cgcgccaggt acgtccagtg tgcccgagcc gcgggcgtcc cctgccgctg cttcctcttc accgccactc tggagcaggc gcgccacaac aaccggtttc gagagatgac ggactcctct catatccccg tgtcagacat ggtcatgtat ggctacagga agcagttcga ggccccaacg ctggctgaag gcttctctgc catcctggag atcccgttcc ggctatgggt ggagccgagg ctggggcggc tgtactgcca gttctccgag ggctga. It is sometimes possible for the material contained within the vial of "PNKP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.