PMPCB cdna clone
PMPCB cDNA Clone
Gene Names
PMPCB; MPPB; P-52; MPP11; MPPP52; Beta-MPP
Synonyms
PMPCB; PMPCB cDNA Clone; PMPCB cdna clone
Sequence
atggcggctgcggcggctcgagtggtgttgtcatccgcggcgcggcggcggctctggggtttcagcgagagtcttctaatccgaggcgctgcgggacggtcattatattttggagagaacagattaagaagtacacaggctgctacccaagttgttctgaatgttcctgaaacaagagtaacatgtttagaaagtggactcagagtagcctcggaagactctgggctctcaacatgcacagttggactctggattgatgctggaagtagatacgaaaatgagaagaacaatggaacagcacactttctggagcatatggctttcaagggcaccaagaagagatcccagttagatctggaacttgagattgaaaatatgggtgctcatctcaatgcctatacctccagagagcagactgtatactatgccaaagcattctctaaagacttgccaagagctgtagaaattcttgctgatataatacaaaacagcacattgggagaagcagagattgaacgtgagcgtggagtaatccttagagagatgcaggaagttgaaaccaatttacaagaagttgtttttgattatcttcatgccacagcttatcaaaatactgcacttggacggacaattttgggaccaactgaaaatatcaaatctataagtcgtaaggacttagtggattatataaccacacattataaggggccaagaatagtgcttgctgctgctggaggtgtttcccatgatgaattgcttgacttagcaaagtttcatttcggtgactctttatgcacacacaaaggagaaataccagctctgcctccctgcaaattcacaggaagtgagattcgtgtgagggatgacaagatgcctttggcgcaccttgcaatagctgttgaagctgttggttgggcacatccagatacaatctgtctcatggttgcaaacacgctgattggcaactgggatcgctcttttgggggaggaatgaatttatctagcaagctggcccagctcacttgtcatggcaatctttgccatagctttcagtctttcaacacttcctacacagatacaggattatggggactgtatatggtttgtgaatcatccactgttgcagacatgctacatgttgttcaaaaagaatggatgcgactctgtacaagtgtcacagaaagtgaggttgcacgagccagaaatcttctgaaaacaaacatgttgttgcagcttgatggttcaactccaatttgtgaagatattggtaggcaaatgttatgctataatagaaggattcccatccctgagcttgaagcaagaattgatgctgtgaatgctgagacaattcgagaagtatgtaccaaatacatttataataggagtccagctattgctgctgttggtaagcctggcttcttttcttctatgcaaaaagttggccaagtacttttaattaactcttctttttaa
Sequence Length
1473
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,366 Da
NCBI Official Full Name
Homo sapiens peptidase (mitochondrial processing) beta, mRNA
NCBI Official Synonym Full Names
peptidase, mitochondrial processing beta subunit
NCBI Official Symbol
PMPCB
NCBI Official Synonym Symbols
MPPB; P-52; MPP11; MPPP52; Beta-MPP
NCBI Protein Information
mitochondrial-processing peptidase subunit beta
UniProt Protein Name
Mitochondrial-processing peptidase subunit beta
UniProt Gene Name
PMPCB
UniProt Synonym Gene Names
MPPB
UniProt Entry Name
MPPB_HUMAN
NCBI Description
This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This protein is located in the mitochondrial matrix and catalyzes the cleavage of the leader peptides of precursor proteins newly imported into the mitochondria, though it only functions as part of a heterodimeric complex. [provided by RefSeq, Jul 2008]
Uniprot Description
PMPCB: Cleaves presequences (transit peptides) from mitochondrial protein precursors. Belongs to the peptidase M16 family.
Protein type: Mitochondrial; Protease; EC 3.4.24.64
Chromosomal Location of Human Ortholog: 7q22.1
Cellular Component: mitochondrial respiratory chain complex III
Molecular Function: metalloendopeptidase activity; zinc ion binding
Biological Process: aerobic respiration; mitochondrial electron transport, ubiquinol to cytochrome c; protein processing
Research Articles on PMPCB
Similar Products
Product Notes
The PMPCB pmpcb (Catalog #AAA1272367) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg cggcggctcg agtggtgttg tcatccgcgg cgcggcggcg gctctggggt ttcagcgaga gtcttctaat ccgaggcgct gcgggacggt cattatattt tggagagaac agattaagaa gtacacaggc tgctacccaa gttgttctga atgttcctga aacaagagta acatgtttag aaagtggact cagagtagcc tcggaagact ctgggctctc aacatgcaca gttggactct ggattgatgc tggaagtaga tacgaaaatg agaagaacaa tggaacagca cactttctgg agcatatggc tttcaagggc accaagaaga gatcccagtt agatctggaa cttgagattg aaaatatggg tgctcatctc aatgcctata cctccagaga gcagactgta tactatgcca aagcattctc taaagacttg ccaagagctg tagaaattct tgctgatata atacaaaaca gcacattggg agaagcagag attgaacgtg agcgtggagt aatccttaga gagatgcagg aagttgaaac caatttacaa gaagttgttt ttgattatct tcatgccaca gcttatcaaa atactgcact tggacggaca attttgggac caactgaaaa tatcaaatct ataagtcgta aggacttagt ggattatata accacacatt ataaggggcc aagaatagtg cttgctgctg ctggaggtgt ttcccatgat gaattgcttg acttagcaaa gtttcatttc ggtgactctt tatgcacaca caaaggagaa ataccagctc tgcctccctg caaattcaca ggaagtgaga ttcgtgtgag ggatgacaag atgcctttgg cgcaccttgc aatagctgtt gaagctgttg gttgggcaca tccagataca atctgtctca tggttgcaaa cacgctgatt ggcaactggg atcgctcttt tgggggagga atgaatttat ctagcaagct ggcccagctc acttgtcatg gcaatctttg ccatagcttt cagtctttca acacttccta cacagataca ggattatggg gactgtatat ggtttgtgaa tcatccactg ttgcagacat gctacatgtt gttcaaaaag aatggatgcg actctgtaca agtgtcacag aaagtgaggt tgcacgagcc agaaatcttc tgaaaacaaa catgttgttg cagcttgatg gttcaactcc aatttgtgaa gatattggta ggcaaatgtt atgctataat agaaggattc ccatccctga gcttgaagca agaattgatg ctgtgaatgc tgagacaatt cgagaagtat gtaccaaata catttataat aggagtccag ctattgctgc tgttggtaag cctggcttct tttcttctat gcaaaaagtt ggccaagtac ttttaattaa ctcttctttt taa. It is sometimes possible for the material contained within the vial of "PMPCB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
