Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PMAIP1 cdna clone

PMAIP1 cDNA Clone

Gene Names
PMAIP1; APR; NOXA
Synonyms
PMAIP1; PMAIP1 cDNA Clone; PMAIP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgggtacggcgagggaccaagccggatttgcgattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctctctttcctcctcgccacttgcccttccccggggccacgaggaacaagtgcaagtagctggaagtcgagtgtgctactcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaacttgcatgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaattga
Sequence Length
411
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,955 Da
NCBI Official Full Name
Homo sapiens phorbol-12-myristate-13-acetate-induced protein 1, mRNA
NCBI Official Synonym Full Names
phorbol-12-myristate-13-acetate-induced protein 1
NCBI Official Symbol
PMAIP1
NCBI Official Synonym Symbols
APR; NOXA
NCBI Protein Information
phorbol-12-myristate-13-acetate-induced protein 1
UniProt Protein Name
Phorbol-12-myristate-13-acetate-induced protein 1
UniProt Gene Name
PMAIP1
UniProt Synonym Gene Names
NOXA; PMA-induced protein 1
UniProt Entry Name
APR_HUMAN

Uniprot Description

NOXA: Promotes activation of caspases and apoptosis. Promotes mitochondrial membrane changes and efflux of apoptogenic proteins from the mitochondria. Contributes to p53/TP53-dependent apoptosis after radiation exposure. Promotes proteasomal degradation of MCL1. Competes with BAK1 for binding to MCL1 and can displace BAK1 from its binding site on MCL1. Competes with BIM/BCL2L11 for binding to MCL1 and can displace BIM/BCL2L11 from its binding site on MCL1. Interacts with MCL1, BCL2A1 and BAX. Up-regulated by p53/TP53, phorbol esters, double- stranded RNA, IFNB1/IFN-beta and viruses. Highly expressed in adult T-cell leukemia cell line. Belongs to the PMAIP1 family.

Protein type: Mitochondrial; Apoptosis

Chromosomal Location of Human Ortholog: 18q21.32

Cellular Component: cytosol; mitochondrial outer membrane; mitochondrion; nucleus

Molecular Function: protein binding

Biological Process: apoptosis; cellular response to glucose starvation; defense response to virus; positive regulation of apoptosis; positive regulation of caspase activity; positive regulation of DNA damage response, signal transduction by p53 class mediator; positive regulation of protein oligomerization; proteasomal protein catabolic process; protein insertion into mitochondrial membrane during induction of apoptosis; regulation of apoptosis; regulation of mitochondrial membrane permeability; response to dsRNA; T cell homeostasis

Research Articles on PMAIP1

Similar Products

Product Notes

The PMAIP1 pmaip1 (Catalog #AAA1277350) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctggga agaaggcgcg caagaacgct caaccgagcc ccgcgcgggc tccagcagga ccggcgggta cggcgggtac ggcgagggac caagccggat ttgcgattgg gatgcagctg cgtttcacca ggggcaaaaa gctcctttcc tcctctcttt cctcctcgcc acttgccctt ccccggggcc acgaggaaca agtgcaagta gctggaagtc gagtgtgcta ctcaactcag gagatttgga gacaaactga acttccggca gaaacttctg aatctgatat ccaaactctt ctgctcagga acctgactgc atcaaaaact tgcatgaggg gactccttca aaagagtttt ctcaggaggt gcacgtttca tcaatttgaa gaaagactgc attgtaattg a. It is sometimes possible for the material contained within the vial of "PMAIP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.