Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLS3 cdna clone

PLS3 cDNA Clone

Gene Names
PLS3; BMND18; T-plastin
Synonyms
PLS3; PLS3 cDNA Clone; PLS3 cdna clone
Ordering
For Research Use Only!
Sequence
atggatgagatggctaccactcagatttccaaagatgagcttgatgaactcaaagaggcctttgcaaaagttgatctcaacagcaacggattcatttgtgactatgaacttcatgagctcttcaaggaagctaatatgccattaccaggatataaagtgagagaaattattcagaaactcatgctggatggtgacaggaataaagatgggaaaataagttttgacgaatttgtttatatttttcaagaggtaaaaagtagtgatattgccaagaccttccgcaaagcaatcaacaggaaagaaggtatttgtgctctgggtggaacttcagagttgtccagcgaaggaacacagcattcttactcagaggaagaaaaatatgcttttgttaactggataaacaaagctttggaaaatgatcctgattgtagacatgttataccaatgaaccctaacaccgatgacctgttcaaagctgttggtgatggaattgtgctttgtaaaatgattaacctttcagttcctgataccattgatgaaagagcaatcaacaagaagaaacttacacccttcatcattcaggaaaacttgaacttggcactgaactctgcttctgccattgggtgtcatgttgtgaacattggtgcagaagatttgagggctgggaaacctcatctggttttgggactgctttggcagatcattaagatcggtttgttcgctgacattgaattaagcaggaatgaagccttggctgctttactccgagatggtgagactttggaggaacttatgaaattgtctccagaagagcttctgcttagatgggcaaactttcatttggaaaactcgggctggcaaaaaattaacaactttagtgctgacatcaaggattccaaagcctatttccatcttctcaatcaaatcgcaccaaaaggacaaaaggaaggtgaaccacggatagatattaacatgtcaggtttcaatgaaacagatgatttgaagagagctgagagtatgcttcaacaagcagataaattaggttgcagacagtttgttacccctgctgatgttgtcagtggaaaccccaaactcaacttagctttcgtggctaacctgtttaataaatacccagcactaactaagccagagaaccaggatattgactggactctattagaaggagaaactcgtgaagaaagaaccttccgtaactggatgaactctcttggtgtcaatcctcacgtaaaccatctctatgctgacctgcaagatgccctggtaatcttacagttatatgaacgaattaaagttcctgttgactggagtaaggttaataaacctccatacccgaaactgggagccaacatgaaaaagctagaaaactgcaactatgctgttgaattagggaagcatcctgctaaattctccctggttggcattggagggcaagacctgaatgatgggaaccaaaccctgactttagctttagtctggcagctgatgagaagatataccctcaatgtcctggaagatcttggagatggtcagaaagccaatgacgacatcattgtgaactgggtgaacagaacgttgagtgaagctggaaaatcaacttccattcagagttttaaggacaagacgatcagctccagtttggcagttgtggatttaattgatgccatccagccaggctgtataaactatgaccttgtgaagagtggcaatctaacagaagatgacaagcacaataatgccaagtatgcagtgtcaatggctagaagaatcggagccagagtgtatgctctccctgaagaccttgtggaagtaaagcccaagatggtcatgactgtgtttgcatgtttgatgggcaggggaatgaagagagtgtaa
Sequence Length
1893
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,632 Da
NCBI Official Full Name
Homo sapiens plastin 3 (T isoform), mRNA
NCBI Official Synonym Full Names
plastin 3
NCBI Official Symbol
PLS3
NCBI Official Synonym Symbols
BMND18; T-plastin
NCBI Protein Information
plastin-3
UniProt Protein Name
Plastin-3
Protein Family
UniProt Gene Name
PLS3
UniProt Entry Name
PLST_HUMAN

NCBI Description

Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). The C-terminal 570 amino acids of the T-plastin and L-plastin proteins are 83% identical. It contains a potential calcium-binding site near the N terminus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]

Uniprot Description

PLS3: Actin-bundling protein found in intestinal microvilli, hair cell stereocilia, and fibroblast filopodia.

Protein type: Actin-binding; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: Xq23

Disease: Bone Mineral Density Quantitative Trait Locus 18

Research Articles on PLS3

Similar Products

Product Notes

The PLS3 pls3 (Catalog #AAA1273231) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgaga tggctaccac tcagatttcc aaagatgagc ttgatgaact caaagaggcc tttgcaaaag ttgatctcaa cagcaacgga ttcatttgtg actatgaact tcatgagctc ttcaaggaag ctaatatgcc attaccagga tataaagtga gagaaattat tcagaaactc atgctggatg gtgacaggaa taaagatggg aaaataagtt ttgacgaatt tgtttatatt tttcaagagg taaaaagtag tgatattgcc aagaccttcc gcaaagcaat caacaggaaa gaaggtattt gtgctctggg tggaacttca gagttgtcca gcgaaggaac acagcattct tactcagagg aagaaaaata tgcttttgtt aactggataa acaaagcttt ggaaaatgat cctgattgta gacatgttat accaatgaac cctaacaccg atgacctgtt caaagctgtt ggtgatggaa ttgtgctttg taaaatgatt aacctttcag ttcctgatac cattgatgaa agagcaatca acaagaagaa acttacaccc ttcatcattc aggaaaactt gaacttggca ctgaactctg cttctgccat tgggtgtcat gttgtgaaca ttggtgcaga agatttgagg gctgggaaac ctcatctggt tttgggactg ctttggcaga tcattaagat cggtttgttc gctgacattg aattaagcag gaatgaagcc ttggctgctt tactccgaga tggtgagact ttggaggaac ttatgaaatt gtctccagaa gagcttctgc ttagatgggc aaactttcat ttggaaaact cgggctggca aaaaattaac aactttagtg ctgacatcaa ggattccaaa gcctatttcc atcttctcaa tcaaatcgca ccaaaaggac aaaaggaagg tgaaccacgg atagatatta acatgtcagg tttcaatgaa acagatgatt tgaagagagc tgagagtatg cttcaacaag cagataaatt aggttgcaga cagtttgtta cccctgctga tgttgtcagt ggaaacccca aactcaactt agctttcgtg gctaacctgt ttaataaata cccagcacta actaagccag agaaccagga tattgactgg actctattag aaggagaaac tcgtgaagaa agaaccttcc gtaactggat gaactctctt ggtgtcaatc ctcacgtaaa ccatctctat gctgacctgc aagatgccct ggtaatctta cagttatatg aacgaattaa agttcctgtt gactggagta aggttaataa acctccatac ccgaaactgg gagccaacat gaaaaagcta gaaaactgca actatgctgt tgaattaggg aagcatcctg ctaaattctc cctggttggc attggagggc aagacctgaa tgatgggaac caaaccctga ctttagcttt agtctggcag ctgatgagaa gatataccct caatgtcctg gaagatcttg gagatggtca gaaagccaat gacgacatca ttgtgaactg ggtgaacaga acgttgagtg aagctggaaa atcaacttcc attcagagtt ttaaggacaa gacgatcagc tccagtttgg cagttgtgga tttaattgat gccatccagc caggctgtat aaactatgac cttgtgaaga gtggcaatct aacagaagat gacaagcaca ataatgccaa gtatgcagtg tcaatggcta gaagaatcgg agccagagtg tatgctctcc ctgaagacct tgtggaagta aagcccaaga tggtcatgac tgtgtttgca tgtttgatgg gcaggggaat gaagagagtg taa. It is sometimes possible for the material contained within the vial of "PLS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.