PLLP cdna clone
PLLP cDNA Clone
Gene Names
PLLP; PMLP; TM4SF11
Synonyms
PLLP; PLLP cDNA Clone; PLLP cdna clone
Sequence
atggccgagttcccgtcgaaagttagcacgcggaccagcagtcctgcgcagggcgccgaagcctcggtgtcggcgctgcgcccggacctgggcttcgtgcgctcccgcctcggggcgctcatgctgctgcagctggtgctggggctgctggtgtgggcgctgattgcggacaccccgtaccacctgtatccggcctatggctgggtgatgttcgtcgctgtcttcctctggctggtgacaatcgtcctcttcaacctctacctgtttcagctgcacatgaagttgtacatggttccctggccactggtgttaatgatctttaacatcagcgccaccgttctctacatcaccgccttcatcgcctgctctgcggcagttgacctgacatccctgaggggcacccggccttataaccagcgcgcggctgcctcgttctttgcgtgtttggtgatgatcgcctatggagtgagtgccttcttcagctaccaggcctggcgaggagtaggcagcaatgcggccaccagtcagatggctggcggctatgcctaa
Sequence Length
549
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,987 Da
NCBI Official Full Name
Homo sapiens plasma membrane proteolipid (plasmolipin), mRNA
NCBI Official Synonym Full Names
plasmolipin
NCBI Official Symbol
PLLP
NCBI Official Synonym Symbols
PMLP; TM4SF11
NCBI Protein Information
plasmolipin
UniProt Protein Name
Plasmolipin
Protein Family
UniProt Gene Name
PLLP
UniProt Synonym Gene Names
PMLP; TM4SF11
UniProt Entry Name
PLLP_HUMAN
Uniprot Description
PLLP: Appears to be involved in myelination. Could also participate in ion transport events as addition of plasmolipin to lipid bilayers induces the formation of ion channels, which are voltage-dependent and K(+)-selective. Belongs to the MAL family.
Protein type: Membrane protein, multi-pass; Cell surface; Membrane protein, integral
Chromosomal Location of Human Ortholog: 16q13
Molecular Function: protein binding
Research Articles on PLLP
Similar Products
Product Notes
The PLLP pllp (Catalog #AAA1271177) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgagt tcccgtcgaa agttagcacg cggaccagca gtcctgcgca gggcgccgaa gcctcggtgt cggcgctgcg cccggacctg ggcttcgtgc gctcccgcct cggggcgctc atgctgctgc agctggtgct ggggctgctg gtgtgggcgc tgattgcgga caccccgtac cacctgtatc cggcctatgg ctgggtgatg ttcgtcgctg tcttcctctg gctggtgaca atcgtcctct tcaacctcta cctgtttcag ctgcacatga agttgtacat ggttccctgg ccactggtgt taatgatctt taacatcagc gccaccgttc tctacatcac cgccttcatc gcctgctctg cggcagttga cctgacatcc ctgaggggca cccggcctta taaccagcgc gcggctgcct cgttctttgc gtgtttggtg atgatcgcct atggagtgag tgccttcttc agctaccagg cctggcgagg agtaggcagc aatgcggcca ccagtcagat ggctggcggc tatgcctaa. It is sometimes possible for the material contained within the vial of "PLLP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
