PLEKHJ1 cdna clone
PLEKHJ1 cDNA Clone
Gene Names
PLEKHJ1; GNRPX
Synonyms
PLEKHJ1; PLEKHJ1 cDNA Clone; PLEKHJ1 cdna clone
Sequence
atgcggtacaacgagaaggagctgcaggctctgtcccggcagccggccgagatggcggccgagctgggcatgaggggccccaagaagggcagcgtgctgaagcggcggctggtgaagctggtggtgaatttcctcttctactttcggacagacgaggccgagcccgtcggagccctgctgctggagcgctgcagagtcgtccgggaagagcccggcaccttctccatcagcttcattgaggaccctgagaggaagtatcactttgagtgcagcagcgaggagcagtgtcaggagtggatggaggctctgcgtcgggccagctacgagttcatgcggagaagcctcatcttctacaggaacgaaatccggaaggtgacgggcaaggaccccctggaacagttcggcatatccgaggaggccaggttccagctgagtggcttgcaggcgtga
Sequence Length
450
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,551 Da
NCBI Official Full Name
Homo sapiens pleckstrin homology domain containing, family J member 1, mRNA
NCBI Official Synonym Full Names
pleckstrin homology domain containing J1
NCBI Official Symbol
PLEKHJ1
NCBI Official Synonym Symbols
GNRPX
NCBI Protein Information
pleckstrin homology domain-containing family J member 1
UniProt Protein Name
Pleckstrin homology domain-containing family J member 1
Protein Family
UniProt Gene Name
PLEKHJ1
UniProt Synonym Gene Names
GNRPX; PH domain-containing family J member 1
UniProt Entry Name
PKHJ1_HUMAN
Uniprot Description
PLEKHJ1:
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 19p13.3
Similar Products
Product Notes
The PLEKHJ1 plekhj1 (Catalog #AAA1265958) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggtaca acgagaagga gctgcaggct ctgtcccggc agccggccga gatggcggcc gagctgggca tgaggggccc caagaagggc agcgtgctga agcggcggct ggtgaagctg gtggtgaatt tcctcttcta ctttcggaca gacgaggccg agcccgtcgg agccctgctg ctggagcgct gcagagtcgt ccgggaagag cccggcacct tctccatcag cttcattgag gaccctgaga ggaagtatca ctttgagtgc agcagcgagg agcagtgtca ggagtggatg gaggctctgc gtcgggccag ctacgagttc atgcggagaa gcctcatctt ctacaggaac gaaatccgga aggtgacggg caaggacccc ctggaacagt tcggcatatc cgaggaggcc aggttccagc tgagtggctt gcaggcgtga. It is sometimes possible for the material contained within the vial of "PLEKHJ1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
