Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLAT cdna clone

PLAT cDNA Clone

Gene Names
PLAT; TPA; T-PA
Synonyms
PLAT; PLAT cDNA Clone; PLAT cdna clone
Ordering
For Research Use Only!
Sequence
atggatgcaatgaagagagggctctgctgtgtgctgctgctgtgtggagcagtcttcgtttcgcccagccaggaaatccatgcccgattcagaagaggagccagatcttaccaagtgatctgcagagatgaaaaaacgcagatgatataccagcaacatcagtcatggctgcgccctgtgctcagaagcaaccgggtggaatattgctggtgcaacagtggcagggcacagtgccactcagtgcctgtcaaaagttgcagcgagccaaggtgtttcaacgggggcacctgccagcaggccctgtacttctcagatttcgtgtgccagtgccccgaaggatttgctgggaagtgctgtgaaatagataccagggccacgtgctacgaggaccagggcatcagctacaggggcacgtggagcacagcggagagtggcgccgagtgcaccaactggaacagcagcgcgttggcccagaagccctacagcgggcggaggccagatgccatcaggctgggcctggggaaccacaactactgcagaaacccagatcgagactcaaagccctggtgctacgtctttaaggcggggaagtacagctcagagttctgcagcacccctgcctgctctgagggaaacagtgactgctactttgggaatgggtcagcctaccgtggcacgcacagcctcaccgagtcgggtgcctcctgcctcccgtggaattccatgatcctgataggcaaggtttacacagcacagaaccccagtgcccaggcactgggcctgggcaaacataattactgccggaatcctgatggggatgccaagccctggtgccacgtgctgaagaaccgcaggctgacgtgggagtactgtgatgtgccctcctgctccacctgcggcctgagacagtacagccagcctcagtttcgcatcaaaggagggctcttcgccgacatcgcctcccacccctggcaggctgccatctttgccaagcacaggaggtcgcccggagagcggttcctgtgcgggggcatactcatcagctcctgctggattctctctgccgcccactgcttccaggagaggtttccgccccaccacctgacggtgatcttgggcagaacataccgggtggtccctggcgaggaggagcagaaatttgaagtcgaaaaatacattgtccataaggaattcgatgatgacacttacgacaatgacattgcgctgctgcagctgaaatcggattcgtcccgctgtgcccaggagagcagcgtggtccgcactgtgtgccttcccccggcggacctgcagctgccggactggacggagtgtgagctctccggctacggcaagcatgaggccttgtctcctttctattcggagcggctgaaggaggctcatgtcagactgtacccatccagccgctgcacatcacaacatttacttaacagaacagtcaccgacaacatgctgtgtgctggagacactcggagcggcgggccccaggcaaacttgcacgacgcctgccagggcgattcgggaggccccctggtgtgtctgaacgatggccgcatgactttggtgggcatcatcagctggggcctgggctgtggacagaaggatgtcccgggtgtgtacaccaaggttaccaactacctagactggattcgtgacaacatgcgaccgtga
Sequence Length
1689
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,373 Da
NCBI Official Full Name
Homo sapiens plasminogen activator, tissue, mRNA
NCBI Official Synonym Full Names
plasminogen activator, tissue type
NCBI Official Symbol
PLAT
NCBI Official Synonym Symbols
TPA; T-PA
NCBI Protein Information
tissue-type plasminogen activator
UniProt Protein Name
Tissue-type plasminogen activator
Protein Family
UniProt Gene Name
PLAT
UniProt Synonym Gene Names
t-PA; t-plasminogen activator; tPA
UniProt Entry Name
TPA_HUMAN

NCBI Description

This gene encodes tissue-type plasminogen activator, a secreted serine protease that converts the proenzyme plasminogen to plasmin, a fibrinolytic enzyme. The encoded preproprotein is proteolytically processed by plasmin or trypsin to generate heavy and light chains. These chains associate via disulfide linkages to form the heterodimeric enzyme. This enzyme plays a role in cell migration and tissue remodeling. Increased enzymatic activity causes hyperfibrinolysis, which manifests as excessive bleeding, while decreased activity leads to hypofibrinolysis, which can result in thrombosis or embolism. Alternative splicing of this gene results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]

Uniprot Description

PLAT: Converts the abundant, but inactive, zymogen plasminogen to plasmin by hydrolyzing a single Arg-Val bond in plasminogen. By controlling plasmin-mediated proteolysis, it plays an important role in tissue remodeling and degradation, in cell migration and many other physiopathological events. Plays a direct role in facilitating neuronal migration. Increased activity of TPA results in increased fibrinolysis of fibrin blood clots that is associated with excessive bleeding. Defective release of TPA results in hypofibrinolysis that can lead to thrombosis or embolism. Belongs to the peptidase S1 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal; EC 3.4.21.68; Motility/polarity/chemotaxis; Protease; Secreted; Secreted, signal peptide; Vesicle

Chromosomal Location of Human Ortholog: 8p12

Cellular Component: cell surface; cytoplasm; extracellular matrix; extracellular region

Molecular Function: glycoprotein binding; phosphoprotein binding; protein binding; receptor binding; serine-type endopeptidase activity

Biological Process: blood coagulation; fibrinolysis; negative regulation of proteolysis; plasminogen activation; protein modification process; proteolysis

Disease: Thrombophilia, Familial, Due To Decreased Release Of Tissue Plasminogen Activator

Research Articles on PLAT

Similar Products

Product Notes

The PLAT plat (Catalog #AAA1276019) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt tcgcccagcc aggaaatcca tgcccgattc agaagaggag ccagatctta ccaagtgatc tgcagagatg aaaaaacgca gatgatatac cagcaacatc agtcatggct gcgccctgtg ctcagaagca accgggtgga atattgctgg tgcaacagtg gcagggcaca gtgccactca gtgcctgtca aaagttgcag cgagccaagg tgtttcaacg ggggcacctg ccagcaggcc ctgtacttct cagatttcgt gtgccagtgc cccgaaggat ttgctgggaa gtgctgtgaa atagatacca gggccacgtg ctacgaggac cagggcatca gctacagggg cacgtggagc acagcggaga gtggcgccga gtgcaccaac tggaacagca gcgcgttggc ccagaagccc tacagcgggc ggaggccaga tgccatcagg ctgggcctgg ggaaccacaa ctactgcaga aacccagatc gagactcaaa gccctggtgc tacgtcttta aggcggggaa gtacagctca gagttctgca gcacccctgc ctgctctgag ggaaacagtg actgctactt tgggaatggg tcagcctacc gtggcacgca cagcctcacc gagtcgggtg cctcctgcct cccgtggaat tccatgatcc tgataggcaa ggtttacaca gcacagaacc ccagtgccca ggcactgggc ctgggcaaac ataattactg ccggaatcct gatggggatg ccaagccctg gtgccacgtg ctgaagaacc gcaggctgac gtgggagtac tgtgatgtgc cctcctgctc cacctgcggc ctgagacagt acagccagcc tcagtttcgc atcaaaggag ggctcttcgc cgacatcgcc tcccacccct ggcaggctgc catctttgcc aagcacagga ggtcgcccgg agagcggttc ctgtgcgggg gcatactcat cagctcctgc tggattctct ctgccgccca ctgcttccag gagaggtttc cgccccacca cctgacggtg atcttgggca gaacataccg ggtggtccct ggcgaggagg agcagaaatt tgaagtcgaa aaatacattg tccataagga attcgatgat gacacttacg acaatgacat tgcgctgctg cagctgaaat cggattcgtc ccgctgtgcc caggagagca gcgtggtccg cactgtgtgc cttcccccgg cggacctgca gctgccggac tggacggagt gtgagctctc cggctacggc aagcatgagg ccttgtctcc tttctattcg gagcggctga aggaggctca tgtcagactg tacccatcca gccgctgcac atcacaacat ttacttaaca gaacagtcac cgacaacatg ctgtgtgctg gagacactcg gagcggcggg ccccaggcaa acttgcacga cgcctgccag ggcgattcgg gaggccccct ggtgtgtctg aacgatggcc gcatgacttt ggtgggcatc atcagctggg gcctgggctg tggacagaag gatgtcccgg gtgtgtacac caaggttacc aactacctag actggattcg tgacaacatg cgaccgtga. It is sometimes possible for the material contained within the vial of "PLAT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.