Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLA2G2A cdna clone

PLA2G2A cDNA Clone

Gene Names
PLA2G2A; MOM1; PLA2; PLA2B; PLA2L; PLA2S; PLAS1; sPLA2
Synonyms
PLA2G2A; PLA2G2A cDNA Clone; PLA2G2A cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaccctcctactgttggcagtgatcatgatctttggcctactgcaggcccatgggaatttggtgaatttccacagaatgatcaagttgacgacaggaaaggaagccgcactcagttatggcttctacggctgccactgtggcgtgggtggcagaggatcccccaaggatgcaacggatcgctgctgtgtcactcatgactgttgctacaaacgtctggagaaacgtggatgtggcaccaaatttctgagctacaagtttagcaactcggggagcagaatcacctgtgcaaaacaggactcctgcagaagtcaactgtgtgagtgtgataaggctgctgccacctgttttgctagaaacaagacgacctacaataaaaagtaccagtactattccaataaacactgcagagggagcacccctcgttgctga
Sequence Length
435
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,083 Da
NCBI Official Full Name
Homo sapiens phospholipase A2, group IIA (platelets, synovial fluid), mRNA
NCBI Official Synonym Full Names
phospholipase A2 group IIA
NCBI Official Symbol
PLA2G2A
NCBI Official Synonym Symbols
MOM1; PLA2; PLA2B; PLA2L; PLA2S; PLAS1; sPLA2
NCBI Protein Information
phospholipase A2, membrane associated
UniProt Protein Name
Phospholipase A2, membrane associated
Protein Family
UniProt Gene Name
PLA2G2A
UniProt Synonym Gene Names
PLA2B; PLA2L; RASF-A; NPS-PLA2
UniProt Entry Name
PA2GA_HUMAN

NCBI Description

The protein encoded by this gene is a member of the phospholipase A2 family (PLA2). PLA2s constitute a diverse family of enzymes with respect to sequence, function, localization, and divalent cation requirements. This gene product belongs to group II, which contains secreted form of PLA2, an extracellular enzyme that has a low molecular mass and requires calcium ions for catalysis. It catalyzes the hydrolysis of the sn-2 fatty acid acyl ester bond of phosphoglycerides, releasing free fatty acids and lysophospholipids, and thought to participate in the regulation of the phospholipid metabolism in biomembranes. Several alternatively spliced transcript variants with different 5' UTRs have been found for this gene.[provided by RefSeq, Sep 2009]

Uniprot Description

PLA2G2A: Thought to participate in the regulation of the phospholipid metabolism in biomembranes including eicosanoid biosynthesis. Catalyzes the calcium-dependent hydrolysis of the 2- acyl groups in 3-sn-phosphoglycerides. Belongs to the phospholipase A2 family.

Protein type: EC 3.1.1.4; Endoplasmic reticulum; Lipid Metabolism - alpha-linolenic acid; Lipid Metabolism - arachidonic acid; Lipid Metabolism - ether lipid; Lipid Metabolism - glycerophospholipid; Lipid Metabolism - linoleic acid; Mitochondrial; Phospholipase; Secreted; Secreted, signal peptide; Vesicle

Chromosomal Location of Human Ortholog: 1p35

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; extracellular region; extracellular space

Molecular Function: calcium-dependent phospholipase A2 activity; phospholipase A2 activity; phospholipid binding

Biological Process: defense response to Gram-positive bacterium; phosphatidic acid biosynthetic process; phosphatidic acid metabolic process; phospholipid metabolic process; positive regulation of inflammatory response

Disease: Colorectal Cancer

Research Articles on PLA2G2A

Similar Products

Product Notes

The PLA2G2A pla2g2a (Catalog #AAA1268959) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaccc tcctactgtt ggcagtgatc atgatctttg gcctactgca ggcccatggg aatttggtga atttccacag aatgatcaag ttgacgacag gaaaggaagc cgcactcagt tatggcttct acggctgcca ctgtggcgtg ggtggcagag gatcccccaa ggatgcaacg gatcgctgct gtgtcactca tgactgttgc tacaaacgtc tggagaaacg tggatgtggc accaaatttc tgagctacaa gtttagcaac tcggggagca gaatcacctg tgcaaaacag gactcctgca gaagtcaact gtgtgagtgt gataaggctg ctgccacctg ttttgctaga aacaagacga cctacaataa aaagtaccag tactattcca ataaacactg cagagggagc acccctcgtt gctga. It is sometimes possible for the material contained within the vial of "PLA2G2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.