Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PJA1 cdna clone

PJA1 cDNA Clone

Gene Names
PJA1; RNF70; PRAJA1
Synonyms
PJA1; PJA1 cDNA Clone; PJA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtcaggaatctagcaagcctgtatggcccaatccaacaggagggtatcagtccaatacaggtaggaggtatggaagaaggcatgcttatgtcagtttcaggccacccacgagccagcgggaaaggattgccagccagagaaagacgaactccgaagtcccaatgcacagatcagcccccagtcaaaccaccaagaggagccgatcgccattttccactactcgtcgtagttgggacgacagcgagagttcgggaaccaacctgaatattgataatgaggactattccaggtatccgccaagagagtacagagcttcgggtagcagaagaggaatggcctatggacatattgactcttatggggcagatgatagtgaggaggagggggctgggcctgttgagcgaccgccagtgagagggaaaactggcaagtttaaagatgataagctgtatgacccagagaaaggggcaaggtctttggctgggccacctccacatttctctagttttagccgtgatgtgagagaggagcgagacaagttagacccagtccctgcagcaagatgctcagctagcagagctgacttcctgccacaaagtagtgtggcctcacagtcgtcttctgaaggcaagctggctacaaaaggtgacagctcggagagggagagaagggagcaaaatttacctgcacgtcccagcagggctcctgtgagtatttgtggtggtggggaaaacacctcaaagagtgcagaggaacctgtggtcaggcccaaaatcagaaacctggcaagtccaaactgcgtgaaaccaaaaattttttttgatactgatgatgatgacgatatgccacacagtacttccaggtggagggataccgccaatgacaatgagggccactcggatggcctggcaagaagagggagaggcgagagttcaagtggctatcccgagccaaagtaccctgaagacaaacgggaagcgaggagtgaccaagtgaaaccagaaaaggtgccgagacgacgacgcaccatggccgaccctgacttctggacgcacagtgatgattactacaaatactgcgacgaagactctgacagtgacaaagagtggattgctgctctgcgtcggaaatatcgaagccgagagcaaaccctgtcctccagtggcgaaagctgggagactctgccggggaaagaagagcgggaacctccacaggctaaggtgagtgccagcactggcaccagccctggccccggtgctagtgccagtgccggggctggcgccggggccagtgctggcagcaatggcagcaattaccttgaagaagttcgagaaccatctcttcaggaagagcaggcatccctggaagaaggagaaattccttggctccagtaccatgagaatgacagtagcagtgagggggataatgattctggtcacgagttgatgcaacctggggtattcatgctggatggaaacaacaaccttgaagatgactccagtgtgagcgaagacctagaagtggattggagcctctttgatggatttgcagatgggttaggagtggctgaagccatttcctatgtggaccctcagttcctcacctacatggcacttgaagaacgcctggcccaggcaatggaaactgcccttgcgcacttggagtctctcgcagtggatgtagaggtggccaatccaccagcaagcaaggagagcattgacgctcttcccgagatcctggtcactgaagatcatggcgcagttggtcaggagatgtgctgccccatctgctgtagcgaatatgtgaagggggaggtggcaactgagctgccgtgccaccactatttccacaagccgtgtgtgtccatctggcttcagaagtcaggcacctgccccgtgtgccgctgcatgttccctcccccactctaa
Sequence Length
1932
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,729 Da
NCBI Official Full Name
Homo sapiens praja ring finger 1, mRNA
NCBI Official Synonym Full Names
praja ring finger ubiquitin ligase 1
NCBI Official Symbol
PJA1
NCBI Official Synonym Symbols
RNF70; PRAJA1
NCBI Protein Information
E3 ubiquitin-protein ligase Praja-1
UniProt Protein Name
E3 ubiquitin-protein ligase Praja-1
UniProt Gene Name
PJA1
UniProt Synonym Gene Names
RNF70; Praja1
UniProt Entry Name
PJA1_HUMAN

NCBI Description

This gene encodes an enzyme that has E2-dependent E3 ubiquitin-protein ligase activity. This enzyme belongs to a class of ubiquitin ligases that include a RING finger motif, and it can interact with the E2 ubiquitin-conjugating enzyme UbcH5B. This gene is located in an area of chromosome X where several X-linked mental retardation disorders have been associated, and it has also been found as part of a contiguous gene deletion associated with craniofrontonasal syndrome, though a direct link to any disorder has yet to be demonstrated. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]

Uniprot Description

PJA1: Has E2-dependent E3 ubiquitin-protein ligase activity. Ubiquitinates MAGED1 antigen leading to its subsequent degradation by proteasome. May be involved in protein sorting. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.19; Ubiquitin ligase; Ubiquitin conjugating system; Ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: Xq13.1

Cellular Component: cytoplasm

Molecular Function: protein binding

Research Articles on PJA1

Similar Products

Product Notes

The PJA1 pja1 (Catalog #AAA1277666) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtcagg aatctagcaa gcctgtatgg cccaatccaa caggagggta tcagtccaat acaggtagga ggtatggaag aaggcatgct tatgtcagtt tcaggccacc cacgagccag cgggaaagga ttgccagcca gagaaagacg aactccgaag tcccaatgca cagatcagcc cccagtcaaa ccaccaagag gagccgatcg ccattttcca ctactcgtcg tagttgggac gacagcgaga gttcgggaac caacctgaat attgataatg aggactattc caggtatccg ccaagagagt acagagcttc gggtagcaga agaggaatgg cctatggaca tattgactct tatggggcag atgatagtga ggaggagggg gctgggcctg ttgagcgacc gccagtgaga gggaaaactg gcaagtttaa agatgataag ctgtatgacc cagagaaagg ggcaaggtct ttggctgggc cacctccaca tttctctagt tttagccgtg atgtgagaga ggagcgagac aagttagacc cagtccctgc agcaagatgc tcagctagca gagctgactt cctgccacaa agtagtgtgg cctcacagtc gtcttctgaa ggcaagctgg ctacaaaagg tgacagctcg gagagggaga gaagggagca aaatttacct gcacgtccca gcagggctcc tgtgagtatt tgtggtggtg gggaaaacac ctcaaagagt gcagaggaac ctgtggtcag gcccaaaatc agaaacctgg caagtccaaa ctgcgtgaaa ccaaaaattt tttttgatac tgatgatgat gacgatatgc cacacagtac ttccaggtgg agggataccg ccaatgacaa tgagggccac tcggatggcc tggcaagaag agggagaggc gagagttcaa gtggctatcc cgagccaaag taccctgaag acaaacggga agcgaggagt gaccaagtga aaccagaaaa ggtgccgaga cgacgacgca ccatggccga ccctgacttc tggacgcaca gtgatgatta ctacaaatac tgcgacgaag actctgacag tgacaaagag tggattgctg ctctgcgtcg gaaatatcga agccgagagc aaaccctgtc ctccagtggc gaaagctggg agactctgcc ggggaaagaa gagcgggaac ctccacaggc taaggtgagt gccagcactg gcaccagccc tggccccggt gctagtgcca gtgccggggc tggcgccggg gccagtgctg gcagcaatgg cagcaattac cttgaagaag ttcgagaacc atctcttcag gaagagcagg catccctgga agaaggagaa attccttggc tccagtacca tgagaatgac agtagcagtg agggggataa tgattctggt cacgagttga tgcaacctgg ggtattcatg ctggatggaa acaacaacct tgaagatgac tccagtgtga gcgaagacct agaagtggat tggagcctct ttgatggatt tgcagatggg ttaggagtgg ctgaagccat ttcctatgtg gaccctcagt tcctcaccta catggcactt gaagaacgcc tggcccaggc aatggaaact gcccttgcgc acttggagtc tctcgcagtg gatgtagagg tggccaatcc accagcaagc aaggagagca ttgacgctct tcccgagatc ctggtcactg aagatcatgg cgcagttggt caggagatgt gctgccccat ctgctgtagc gaatatgtga agggggaggt ggcaactgag ctgccgtgcc accactattt ccacaagccg tgtgtgtcca tctggcttca gaagtcaggc acctgccccg tgtgccgctg catgttccct cccccactct aa. It is sometimes possible for the material contained within the vial of "PJA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.