PISD cdna clone
PISD cDNA Clone
Gene Names
PISD; PSD; PSDC; PSSC; DJ858B16; dJ858B16.2
Synonyms
PISD; PISD cDNA Clone; PISD cdna clone
Sequence
atgatgtgtcagtcagaggcgcggcaaggaccagagctccgcgcggcgaaatggttgcacttcccccagctggccctgaggcggaggctggggcagctgagctgcatgtccagacccgctctgaaactgcgctcctggcccttgaccgtcctctactacctcctgcccttcggcgccctcagaccgctcagccgggtgggatggaggcccgtaagcagggtggctttgtacaagtcagtgccaacgcgcttgctgtcacgggcctggggtcgcctcaatcaggtggagctgccacactggctgcgcaggcccgtctacagcctgtacatctggacgtttggggtgaacatgaaagaggccgctgtggaggacctgcatcactaccgcaacctcagcgagttcttccggcgcaagctgaagccgcaggcccggcctgtctgtggcctgcacagcgtgattagcccatcggatggaaggatcctcaactttgggcaggtgaagaactgtgaggtggagcaggtaaagggggtcacctactccctggagtcgttcctgggcccgcgtatgtgcacagaggacctgcccttcccaccagccgcgtcgtgtgactccttcaagaaccagctggtcacccgggaagggaatgagctctatcactgtgtcatctacctggcccctggggactaccactgcttccactcccccaccgactggactgtgtcccaccggcgccacttcccaggctccctgatgtcagtgaaccctggcatggctcgctggatcaaagagctcttctgccataacgagcgggtggtcctgacgggggactggaaacatggcttcttctcactgacagctgtgggggccaccaacgtgggctccattcgcatctactttgaccgggacctgcacacaaacagcccaaggcacagcaagggctcctacaatgacttcagcttcgtgacgcacaccaatagagagggcgtccccatgcgtaagggcgagcacctgggcgagttcaacctgggctccaccatcgtgctcatcttcgaggcccccaaggacttcaatttccagctgaaaacaggacagaaaatccgctttggggaagccctgggctcgctctag
Sequence Length
1128
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,047 Da
NCBI Official Full Name
Homo sapiens phosphatidylserine decarboxylase, mRNA
NCBI Official Synonym Full Names
phosphatidylserine decarboxylase
NCBI Official Symbol
PISD
NCBI Official Synonym Symbols
PSD; PSDC; PSSC; DJ858B16; dJ858B16.2
NCBI Protein Information
phosphatidylserine decarboxylase proenzyme, mitochondrial
UniProt Protein Name
Phosphatidylserine decarboxylase proenzyme, mitochondrial
UniProt Gene Name
PISD
UniProt Entry Name
PISD_HUMAN
NCBI Description
The protein encoded by this gene catalyzes the conversion of phosphatidylserine to phosphatidylethanolamine in the inner mitochondrial membrane. The encoded protein is active in phospholipid metabolism and interorganelle trafficking of phosphatidylserine. [provided by RefSeq, May 2016]
Uniprot Description
PISD: Belongs to the phosphatidylserine decarboxylase family. Heterodimer. 2 isoforms of the human protein are produced by alternative splicing
Protein type: Endoplasmic reticulum; EC 4.1.1.65; Lipid Metabolism - glycerophospholipid; Lyase
Chromosomal Location of Human Ortholog: 22q12.2
Cellular Component: nucleus
Research Articles on PISD
Similar Products
Product Notes
The PISD pisd (Catalog #AAA1268452) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgtgtc agtcagaggc gcggcaagga ccagagctcc gcgcggcgaa atggttgcac ttcccccagc tggccctgag gcggaggctg gggcagctga gctgcatgtc cagacccgct ctgaaactgc gctcctggcc cttgaccgtc ctctactacc tcctgccctt cggcgccctc agaccgctca gccgggtggg atggaggccc gtaagcaggg tggctttgta caagtcagtg ccaacgcgct tgctgtcacg ggcctggggt cgcctcaatc aggtggagct gccacactgg ctgcgcaggc ccgtctacag cctgtacatc tggacgtttg gggtgaacat gaaagaggcc gctgtggagg acctgcatca ctaccgcaac ctcagcgagt tcttccggcg caagctgaag ccgcaggccc ggcctgtctg tggcctgcac agcgtgatta gcccatcgga tggaaggatc ctcaactttg ggcaggtgaa gaactgtgag gtggagcagg taaagggggt cacctactcc ctggagtcgt tcctgggccc gcgtatgtgc acagaggacc tgcccttccc accagccgcg tcgtgtgact ccttcaagaa ccagctggtc acccgggaag ggaatgagct ctatcactgt gtcatctacc tggcccctgg ggactaccac tgcttccact cccccaccga ctggactgtg tcccaccggc gccacttccc aggctccctg atgtcagtga accctggcat ggctcgctgg atcaaagagc tcttctgcca taacgagcgg gtggtcctga cgggggactg gaaacatggc ttcttctcac tgacagctgt gggggccacc aacgtgggct ccattcgcat ctactttgac cgggacctgc acacaaacag cccaaggcac agcaagggct cctacaatga cttcagcttc gtgacgcaca ccaatagaga gggcgtcccc atgcgtaagg gcgagcacct gggcgagttc aacctgggct ccaccatcgt gctcatcttc gaggccccca aggacttcaa tttccagctg aaaacaggac agaaaatccg ctttggggaa gccctgggct cgctctag. It is sometimes possible for the material contained within the vial of "PISD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
