Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIK3CG cdna clone

PIK3CG cDNA Clone

Gene Names
PIK3CG; PI3K; PIK3; PI3CG; PI3Kgamma; p110gamma; p120-PI3K
Synonyms
PIK3CG; PIK3CG cDNA Clone; PIK3CG cdna clone
Ordering
For Research Use Only!
Sequence
atggagctggagaactataaacagcccgtggtgctgagagaggacaactgccgaaggcgccggaggatgaagccgcgcagtgctgcggccagcctgtcctccatggagctcatccccatcgagttcgtgctgcccaccagccagcgcaaatgcaagagccccgaaacggcgctgctgcacgtggccggccacggcaacgtggagcagatgaaggcccaggtgtggctgcgagcgctggagaccagcgtggcggcggacttctaccaccggctgggaccgcatcacttcctcctgctctatcagaagaaggggcagtggtacgagatctacgacaagtaccaggtggtgcagactctggactgcctgcgctactggaaggccacgcaccggagcccgggccagatccacctggtgcagcggcacccgccctccgaggagtcccaagccttccagcggcagctcacggcgctgattggctatgacgtcactgacgtcagcaacgtgcacgacgatgagctggagttcacgcgccgtggcttggtgaccccgcgcatggcggaggtggccagccgcgaccccaagctctacgccatgcacccgtgggtgacgtccaagcccctcccggagtacctgtggaagaagattgccaacaactgcatcttcatcgtcattcaccgcagcaccaccagccagaccattaaggtctcacccgacgacacccccggcgccatcctgcagagcttcttcaccaagatggccaagaagaaatctctgatggatattcccgaaagccaaagcgaacaggattttgtgctgcgcgtctgtggccgggatgagtacctggtgggcgaaacgcccatcaaaaacttccagtgggtgaggcactgcctcaagaacggagaagagattcacgtggtactggacacgcctccagacccggccctagacgaggtgaggaaggaagagtggccgctggtggacgactgcacgggagtcaccggctaccatgagcagcttaccatccacggcaaggaccacgagagtgtgttcaccgtgtccctgtgggactgcgaccgcaagttcagggtcaagatcagaggcattgatatccccgtcctgcctcggaacaccgacctcacagtttttgtagaggcaaacatccagcatgggcaacaagtcctttgccaaaggagaaccagccccaaacccttcacagaggaggtgctgtggaatgtgtggcttgagttcagtatcaaaatcaaagacttgcccaaaggggctctactgaacctccagatctactgcggtaaagctccagcactgtccagcaaggcctctgcagagtcccccagttctgagtccaagggcaaagttcagcttctctattatgtgaacctgctgctgatagaccaccgtttcctcctgcgccgtggagaatacgtcctccacatgtggcagatatctgggaagggagaagaccaaggaagcttcaatgctgacaaactcacgtctgcaactaacccagacaaggagaactcaatgtccatctccattcttctggacaattactgccacccgatagccctgcctaagcatcagcccacccctgacccggaaggggaccgggttcgagcagaaatgcccaaccagcttcgcaagcaattggaggcgatcatagccactgatccacttaaccctctcacagcagaggacaaagaattgctctggcattttagatacgaaagccttaagcacccaaaagcatatcctaagctatttagttcagtgaaatggggacagcaagaaattgtggccaaaacataccaattgttggccagaagggaagtctgggatcaaagtgctttggatgttgggttaacaatgcagctcctggactgcaacttctcagatgaaaatgtaagagccattgcagttcagaaactggagagcttggaggacgatgatgttctgcattaccttctacaattggtccaggctgtgaaatttgaaccataccatgatagtgcccttgccagatttctgctgaagcgtggtttaagaaacaaaagaattggtcactttttgttttggttcttgagaagtgagatagcccagtccagacactatcagcagaggttcgctgtgattctggaagcctatctgaggggctgtggcacagccatgctgcacgactttacccaacaagtccaagtaatcgagatgttacaaaaagtcacccttgatattaaatcgctctctgctgaaaagtatgacgtcagttcccaagttatttcacaacttaaacaaaagcttgaaaacctgcagaattctcaactccccgaaagctttagagttccatatgatcctggactgaaagcaggagcgctggcaattgaaaaatgtaaagtaatggcctccaagaaaaaaccactatggcttgagtttaaatgtgccgatcctacagccctatcaaatgaaacaattggaattatctttaaacatggtgatgatctgcgccaagacatgcttattttacagattctacgaatcatggagtctatttgggagactgaatctttggatctatgcctcctgccatatggttgcatttcaactggtgacaaaataggaatgatcgagattgtgaaagacgccacgacaattgccaaaattcagcaaagcacagtgggcaacacgggagcatttaaagatgaagtcctgaatcactggctcaaagaaaaatcccctactgaagaaaagtttcaggcagcagtggagagatttgtttattcctgtgcaggctactgtgtggcaacctttgttcttggaataggcgacagacacaatgacaatattatgatcaccgagacaggaaacctatttcatattgacttcgggcacattcttgggaattacaaaagtttcctgggcattaataaagagagagtgccatttgtgctaacccctgacttcctctttgtgatgggaacttctggaaagaagacaagcccacacttccagaaatttcaggacatctgtgttaaggcttatctagcccttcgtcatcacacaaacctactgatcatcctgttctccatgatgctgatgacaggaatgccccagttaacaagcaaagaagacattgaatatatccgggatgccctcacagtggggaaaaatgaggaggatgctaaaaagtattttcttgatcagatcgaagtttgcagagacaaaggatggactgtgcagtttaattggtttctacatcttgttcttggcatcaaacaaggagagaaacattcagcctaa
Sequence Length
3309
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
126,454 Da
NCBI Official Full Name
Homo sapiens phosphoinositide-3-kinase, catalytic, gamma polypeptide, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
NCBI Official Symbol
PIK3CG
NCBI Official Synonym Symbols
PI3K; PIK3; PI3CG; PI3Kgamma; p110gamma; p120-PI3K
NCBI Protein Information
phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit gamma isoform
UniProt Protein Name
Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit gamma isoform
UniProt Gene Name
PIK3CG
UniProt Synonym Gene Names
PI3-kinase subunit gamma; PI3K-gamma; PI3Kgamma; PtdIns-3-kinase subunit gamma; PtdIns-3-kinase subunit p110-gamma; p110gamma
UniProt Entry Name
PK3CG_HUMAN

NCBI Description

Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]

Uniprot Description

PIK3CG: catalytic subunit of the PI3/PI4-kinase family of phospholipid-kinases. Phosphorylates phosphoinositides on the 3-hydroxyl group of the inositol ring. Phosphorylates PtdIns(4,5)P2 (Phosphatidylinositol 4,5-bisphosphate) to generate phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 recruits proteins with PH domains to the membrane, including AKT1 and PDPK1, and plays a critical pleiotropic role in regulating membrane signaling. Activated by both the alpha and the beta:gamma G proteins following stimulation of G protein-coupled receptors (GPCRs), linking GPCR activation to PIP3 production. Activation by GPCRs is assisted by the regulatory subunits (PIK3R5 or PIK3R6), leading to the translocation from the cytosol to the plasma membrane. Inhibited by AS-604850 and AS-605240. Activates signaling cascades involved in cell growth, survival, proliferation, motility and morphology. Involved in immune, inflammatory and allergic responses. Modulates leukocyte chemotaxis to inflammatory sites and in response to chemoattractant agents. May control leukocyte polarization and migration by regulating the spatial accumulation of PIP3 and by regulating the organization of F-actin formation and integrin-based adhesion at the leading edge. Controls motility of dendritic cells. Together with PIK3CD, it regulates many cellular functions: it is involved in natural killer (NK) cell development and migration towards the sites of inflammation; participates in T-lymphocyte development and migration; required for B-lymphocyte development and signaling; regulates lymphocyte cytokine production; participates in neutrophil respiratory burst, chemotaxis and extravasation; promotes platelet aggregation and thrombosis; regulates alpha-IIb/beta-3 integrins (ITGA2B/ ITGB3) adhesive function in platelets downstream of P2Y12 through a lipid kinase activity-independent mechanism; involved in endothelial progenitor cell migration; modulates cardiac contractility by anchoring protein kinase A (PKA) and PDE3B activation, reducing cAMP levels; regulates cardiac contractility also by promoting beta-adrenergic receptor internalization by binding to ADRBK1 and by non-muscle tropomyosin phosphorylation; and contributes to cardiac hypertrophy under pathological stress. Possesses serine/threonine protein kinase activity: both lipid and protein kinase activities are required for beta-adrenergic receptor endocytosis. Through simultaneous binding of PDE3B to RAPGEF3 and PIK3R6 is assembled in a signaling complex in which the PI3K gamma complex is activated by RAPGEF3 and which is involved in angiogenesis. Holoenzyme is a trimer composed of a heterodimer of a catalytic subunit PIK3CG and a PIK3R5 or PIK3R6 regulatory subunit. Interacts with HRAS1; the interaction is required for membrane recruitment and beta-gamma G protein dimer-dependent activation of the PI3K gamma complex PIK3CG:PIK3R6.

Protein type: Carbohydrate Metabolism - inositol phosphate; Kinase, lipid; Autophagy; Motility/polarity/chemotaxis; EC 2.7.11.1; EC 2.7.1.153

Chromosomal Location of Human Ortholog: 7q22.3

Cellular Component: cytoplasm; cytosol; membrane; plasma membrane

Molecular Function: ephrin receptor binding; phosphatidylinositol-4,5-bisphosphate 3-kinase activity; phosphatidylinositol-4-phosphate 3-kinase activity; phosphoinositide 3-kinase activity; protein binding; protein kinase activity

Biological Process: adaptive immune response; cytokine production; dendritic cell chemotaxis; G-protein coupled receptor protein signaling pathway; inflammatory response; innate immune response; mast cell degranulation; neutrophil chemotaxis; phosphatidylinositol biosynthetic process; phosphoinositide 3-kinase cascade; platelet activation; positive regulation of MAP kinase activity; positive regulation of protein kinase B signaling cascade; regulation of cell adhesion mediated by integrin; respiratory burst during defense response; T cell activation; T cell proliferation

Research Articles on PIK3CG

Similar Products

Product Notes

The PIK3CG pik3cg (Catalog #AAA1277713) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctgg agaactataa acagcccgtg gtgctgagag aggacaactg ccgaaggcgc cggaggatga agccgcgcag tgctgcggcc agcctgtcct ccatggagct catccccatc gagttcgtgc tgcccaccag ccagcgcaaa tgcaagagcc ccgaaacggc gctgctgcac gtggccggcc acggcaacgt ggagcagatg aaggcccagg tgtggctgcg agcgctggag accagcgtgg cggcggactt ctaccaccgg ctgggaccgc atcacttcct cctgctctat cagaagaagg ggcagtggta cgagatctac gacaagtacc aggtggtgca gactctggac tgcctgcgct actggaaggc cacgcaccgg agcccgggcc agatccacct ggtgcagcgg cacccgccct ccgaggagtc ccaagccttc cagcggcagc tcacggcgct gattggctat gacgtcactg acgtcagcaa cgtgcacgac gatgagctgg agttcacgcg ccgtggcttg gtgaccccgc gcatggcgga ggtggccagc cgcgacccca agctctacgc catgcacccg tgggtgacgt ccaagcccct cccggagtac ctgtggaaga agattgccaa caactgcatc ttcatcgtca ttcaccgcag caccaccagc cagaccatta aggtctcacc cgacgacacc cccggcgcca tcctgcagag cttcttcacc aagatggcca agaagaaatc tctgatggat attcccgaaa gccaaagcga acaggatttt gtgctgcgcg tctgtggccg ggatgagtac ctggtgggcg aaacgcccat caaaaacttc cagtgggtga ggcactgcct caagaacgga gaagagattc acgtggtact ggacacgcct ccagacccgg ccctagacga ggtgaggaag gaagagtggc cgctggtgga cgactgcacg ggagtcaccg gctaccatga gcagcttacc atccacggca aggaccacga gagtgtgttc accgtgtccc tgtgggactg cgaccgcaag ttcagggtca agatcagagg cattgatatc cccgtcctgc ctcggaacac cgacctcaca gtttttgtag aggcaaacat ccagcatggg caacaagtcc tttgccaaag gagaaccagc cccaaaccct tcacagagga ggtgctgtgg aatgtgtggc ttgagttcag tatcaaaatc aaagacttgc ccaaaggggc tctactgaac ctccagatct actgcggtaa agctccagca ctgtccagca aggcctctgc agagtccccc agttctgagt ccaagggcaa agttcagctt ctctattatg tgaacctgct gctgatagac caccgtttcc tcctgcgccg tggagaatac gtcctccaca tgtggcagat atctgggaag ggagaagacc aaggaagctt caatgctgac aaactcacgt ctgcaactaa cccagacaag gagaactcaa tgtccatctc cattcttctg gacaattact gccacccgat agccctgcct aagcatcagc ccacccctga cccggaaggg gaccgggttc gagcagaaat gcccaaccag cttcgcaagc aattggaggc gatcatagcc actgatccac ttaaccctct cacagcagag gacaaagaat tgctctggca ttttagatac gaaagcctta agcacccaaa agcatatcct aagctattta gttcagtgaa atggggacag caagaaattg tggccaaaac ataccaattg ttggccagaa gggaagtctg ggatcaaagt gctttggatg ttgggttaac aatgcagctc ctggactgca acttctcaga tgaaaatgta agagccattg cagttcagaa actggagagc ttggaggacg atgatgttct gcattacctt ctacaattgg tccaggctgt gaaatttgaa ccataccatg atagtgccct tgccagattt ctgctgaagc gtggtttaag aaacaaaaga attggtcact ttttgttttg gttcttgaga agtgagatag cccagtccag acactatcag cagaggttcg ctgtgattct ggaagcctat ctgaggggct gtggcacagc catgctgcac gactttaccc aacaagtcca agtaatcgag atgttacaaa aagtcaccct tgatattaaa tcgctctctg ctgaaaagta tgacgtcagt tcccaagtta tttcacaact taaacaaaag cttgaaaacc tgcagaattc tcaactcccc gaaagcttta gagttccata tgatcctgga ctgaaagcag gagcgctggc aattgaaaaa tgtaaagtaa tggcctccaa gaaaaaacca ctatggcttg agtttaaatg tgccgatcct acagccctat caaatgaaac aattggaatt atctttaaac atggtgatga tctgcgccaa gacatgctta ttttacagat tctacgaatc atggagtcta tttgggagac tgaatctttg gatctatgcc tcctgccata tggttgcatt tcaactggtg acaaaatagg aatgatcgag attgtgaaag acgccacgac aattgccaaa attcagcaaa gcacagtggg caacacggga gcatttaaag atgaagtcct gaatcactgg ctcaaagaaa aatcccctac tgaagaaaag tttcaggcag cagtggagag atttgtttat tcctgtgcag gctactgtgt ggcaaccttt gttcttggaa taggcgacag acacaatgac aatattatga tcaccgagac aggaaaccta tttcatattg acttcgggca cattcttggg aattacaaaa gtttcctggg cattaataaa gagagagtgc catttgtgct aacccctgac ttcctctttg tgatgggaac ttctggaaag aagacaagcc cacacttcca gaaatttcag gacatctgtg ttaaggctta tctagccctt cgtcatcaca caaacctact gatcatcctg ttctccatga tgctgatgac aggaatgccc cagttaacaa gcaaagaaga cattgaatat atccgggatg ccctcacagt ggggaaaaat gaggaggatg ctaaaaagta ttttcttgat cagatcgaag tttgcagaga caaaggatgg actgtgcagt ttaattggtt tctacatctt gttcttggca tcaaacaagg agagaaacat tcagcctaa. It is sometimes possible for the material contained within the vial of "PIK3CG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.