Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIGO cdna clone

PIGO cDNA Clone

Gene Names
PIGO; HPMRS2
Synonyms
PIGO; PIGO cDNA Clone; PIGO cdna clone
Ordering
For Research Use Only!
Sequence
atggacagtggtgaatgggaagtgagcaatcagcacgtcctgggtgtggaccactgtggtcacaagcatggccctcaccaccctgaaatggccaagaaacttagccagatggaccaggtgatccagggacttgtggagcgtctggagaatgacacactgctggtagtggctggggaccatgggatgaccacaaatggagaccatggaggggacagtgagctggaggtctcagctgctctctttctgtatagccccacagcagtcttccccagcaccccaccagaggagccagaggtgattcctcaagttagccttgtgcccacgctggccctgctgctgggcctgcccatcccatttgggaatatcggggaagtgatggctgagctattctcagggggtgaggactcccagccccactcctctgctttagcccaagcctcagctctccatctcaatgctcagcaggtgtcccgatttcttcatacctactcagctgctactcaggaccttcaagctaaggagcttcatcagctgcagaacctcttctccaaggcctctgctgactaccagtggcttctccagagccccaagggggctgaggcgacactgccgactgtgattgctgagctgcagcagttcctgcggggagctcgggccatgtgcatcgagtcttgggctcgtttctctctgagcttccttctcctacatctgcttgctgctgggatacccgtcaccacccctggtccttttactgtgccatggcaggcagtctcggcttgggccctcatggccacacagaccttctactccacaggccaccagcctgtctttccagccatccattggcatgcagccttcgtgggattcccagagggtcatggctcctgtacttggctgcctgctttgctagtgggagccaacacctttgcctcccacctcctctttgcagtaggttgcccactgctcctgctctggcctttcctgtgtgagagtcaagggctgcggaagagacagcagcccccagggaatgaagctgatgccagagtcagacccgaggaggaagaggagccactgatggagatgcggctccgggatgcgcctcagcacttctatgcagcactgctgcagctgggcctcaagtacctctttatccttggtattcagattctggcctgtgccttggcagcctccatccttcgcaggcatctcatggtctggaaagtgtttgcccctaagttcatatttgaggctgtgggcttcattgtgagcagcgtgggacttctcctgggcatagctttggtgatgagagtggatggtgctgtgagctcctggttcaggcagctatttctggcccagcagaggtag
Sequence Length
1365
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,992 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class O, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol glycan anchor biosynthesis class O
NCBI Official Symbol
PIGO
NCBI Official Synonym Symbols
HPMRS2
NCBI Protein Information
GPI ethanolamine phosphate transferase 3
UniProt Protein Name
GPI ethanolamine phosphate transferase 3
UniProt Gene Name
PIGO
UniProt Synonym Gene Names
PIG-O
UniProt Entry Name
PIGO_HUMAN

NCBI Description

This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

PIGO: Ethanolamine phosphate transferase involved in glycosylphosphatidylinositol-anchor biosynthesis. Transfers ethanolamine phosphate to the GPI third mannose which links the GPI-anchor to the C-terminus of the proteins by an amide bond. Belongs to the PIGG/PIGN/PIGO family. PIGO subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Transferase; Glycan Metabolism - glycosylphosphatidylinositol (GPI)-anchor biosynthesis; Endoplasmic reticulum; Membrane protein, integral; EC 2.-.-.-

Chromosomal Location of Human Ortholog: 9p13.3

Cellular Component: endoplasmic reticulum membrane; membrane

Molecular Function: mannose-ethanolamine phosphotransferase activity

Biological Process: GPI anchor biosynthetic process

Disease: Hyperphosphatasia With Mental Retardation Syndrome 2

Research Articles on PIGO

Similar Products

Product Notes

The PIGO pigo (Catalog #AAA1272455) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagtg gtgaatggga agtgagcaat cagcacgtcc tgggtgtgga ccactgtggt cacaagcatg gccctcacca ccctgaaatg gccaagaaac ttagccagat ggaccaggtg atccagggac ttgtggagcg tctggagaat gacacactgc tggtagtggc tggggaccat gggatgacca caaatggaga ccatggaggg gacagtgagc tggaggtctc agctgctctc tttctgtata gccccacagc agtcttcccc agcaccccac cagaggagcc agaggtgatt cctcaagtta gccttgtgcc cacgctggcc ctgctgctgg gcctgcccat cccatttggg aatatcgggg aagtgatggc tgagctattc tcagggggtg aggactccca gccccactcc tctgctttag cccaagcctc agctctccat ctcaatgctc agcaggtgtc ccgatttctt catacctact cagctgctac tcaggacctt caagctaagg agcttcatca gctgcagaac ctcttctcca aggcctctgc tgactaccag tggcttctcc agagccccaa gggggctgag gcgacactgc cgactgtgat tgctgagctg cagcagttcc tgcggggagc tcgggccatg tgcatcgagt cttgggctcg tttctctctg agcttccttc tcctacatct gcttgctgct gggatacccg tcaccacccc tggtcctttt actgtgccat ggcaggcagt ctcggcttgg gccctcatgg ccacacagac cttctactcc acaggccacc agcctgtctt tccagccatc cattggcatg cagccttcgt gggattccca gagggtcatg gctcctgtac ttggctgcct gctttgctag tgggagccaa cacctttgcc tcccacctcc tctttgcagt aggttgccca ctgctcctgc tctggccttt cctgtgtgag agtcaagggc tgcggaagag acagcagccc ccagggaatg aagctgatgc cagagtcaga cccgaggagg aagaggagcc actgatggag atgcggctcc gggatgcgcc tcagcacttc tatgcagcac tgctgcagct gggcctcaag tacctcttta tccttggtat tcagattctg gcctgtgcct tggcagcctc catccttcgc aggcatctca tggtctggaa agtgtttgcc cctaagttca tatttgaggc tgtgggcttc attgtgagca gcgtgggact tctcctgggc atagctttgg tgatgagagt ggatggtgct gtgagctcct ggttcaggca gctatttctg gcccagcaga ggtag. It is sometimes possible for the material contained within the vial of "PIGO, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.