PIGG cdna clone
PIGG cDNA Clone
Gene Names
PIGG; GPI7; LAS21; MRT53; PRO4405; RLGS1930
Synonyms
PIGG; PIGG cDNA Clone; PIGG cdna clone
Sequence
atgtcagaaagattgcatgggaactggatcagactgtacttggaggaaaagcattcagaagtcctattcaacctgggctccaaggttctcaggcagtacctggatgctctgaagacgctgagcttgtccctgagtgcacaagtggcccagtacgacatctattcgatgatggtggggactgtcgtggttttggaggttctcaccctgctcctgctcagcgtcccacaggcactgcgcagaaaggctgagctggaagtcccactgtcatctcctgggttttctctgctcttttatttggtgatcctggttctttcggccgttcacgtcattgtgtgcacctcagctgaaagttcgtgctacttctgtggcctctcgtggctggcggcaggtggggtgatggtgctggcctcggcgctgctgtgtgtgattgtgtctgttctgaccaacgtgctcgtgggtggaaacaccccaaggaagaaccccatgcatcccagctcaaggtggtcagagctagaccttcttattctgttggggacggcgggccacgtcttgagcctgggcgccagcagcttcgtggaggaggagcaccagacctggtacttccttgtgaacaccctgtgtctagctctgagccaagaaacctacagaaactactttctgggagatgacggtgagcctccgtgtggcctctgtgtggaacaagggcatgacggggccacagcagcgtggcaggacgggcctggctgtgatgtcctggagcgagacaaaggccacggaagcccctctacctccgaagtgctcagaggccgcgagaagtggatggtgctggccagtccgtggctaatactggcctgctgccggctgctgcgctccctaaaccagacaggtgtgcagtgggctcaccggcctgacctcggccactggctcaccagctctgaccacaaagccgagctctctgtcctggctgccctctccctcctcgtagtttttgtgctggtgcagagggggtgctcccctgtgtccaaggctgccctggcgctggggctgctgggcgtctactgctaccgggcggccatcgggagtgtccggttcccgtggcggccggacagcaaggacatttccaagggtattattgaagctcgttttgtttatgtctttgtccttggcattctgttcacgggcaccaaagacttacttaaatctcaagtcattgctgcagacttcaaactcaagactgtaggtttatgggagatatatagtggattagttcttctggcagccttgctctttagaccacataatcttccggtcttagcatttagcctcttgattcagactctaatgactaaattcatctggaagcccctgagacacgatgcagctgagattactgtgatgcattattggtttggtcaagcattcttctattttcagggcaactccaacaacattgccaccgtggacatctccgcaggcttcgtgggcttagacacctacgtggaaatcccagccgtgctcctgacagcgtttgggacgtacgcagggcctgtgctgtgggccagccacttagtgcacttcctgagctcagaaacacgcagtggttcagcactgagtcatgcttgcttctgctacgcactgatttgttctattccagttttcacgtacatcgttttggtgacatctctgcgttatcatttatttatatggagtgtattttctccaaaacttctctacgagggaatgcacctgctcattacagctgctgtctgtgtattcttcacggcaatggatcaaaccagactcacacagtcttag
Sequence Length
1815
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,290 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class G, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol glycan anchor biosynthesis class G
NCBI Official Symbol
PIGG
NCBI Official Synonym Symbols
GPI7; LAS21; MRT53; PRO4405; RLGS1930
NCBI Protein Information
GPI ethanolamine phosphate transferase 2
UniProt Protein Name
GPI ethanolamine phosphate transferase 2
Protein Family
UniProt Gene Name
PIGG
UniProt Synonym Gene Names
GPI7; hGPI7; PIG-G
UniProt Entry Name
PIGG_HUMAN
Uniprot Description
PIGG: Ethanolamine phosphate transferase involved in glycosylphosphatidylinositol-anchor biosynthesis. Transfers ethanolamine phosphate to the GPI second mannose. Belongs to the PIGG/PIGN/PIGO family. PIGG subfamily. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass; EC 2.-.-.-; Transferase; Glycan Metabolism - glycosylphosphatidylinositol (GPI)-anchor biosynthesis
Chromosomal Location of Human Ortholog: 4p16.3
Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane; membrane
Molecular Function: CP2 mannose-ethanolamine phosphotransferase activity; phosphotransferase activity, for other substituted phosphate groups
Biological Process: GPI anchor biosynthetic process; preassembly of GPI anchor in ER membrane
Disease: Mental Retardation, Autosomal Recessive 53
Research Articles on PIGG
Similar Products
Product Notes
The PIGG pigg (Catalog #AAA1274263) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagaaa gattgcatgg gaactggatc agactgtact tggaggaaaa gcattcagaa gtcctattca acctgggctc caaggttctc aggcagtacc tggatgctct gaagacgctg agcttgtccc tgagtgcaca agtggcccag tacgacatct attcgatgat ggtggggact gtcgtggttt tggaggttct caccctgctc ctgctcagcg tcccacaggc actgcgcaga aaggctgagc tggaagtccc actgtcatct cctgggtttt ctctgctctt ttatttggtg atcctggttc tttcggccgt tcacgtcatt gtgtgcacct cagctgaaag ttcgtgctac ttctgtggcc tctcgtggct ggcggcaggt ggggtgatgg tgctggcctc ggcgctgctg tgtgtgattg tgtctgttct gaccaacgtg ctcgtgggtg gaaacacccc aaggaagaac cccatgcatc ccagctcaag gtggtcagag ctagaccttc ttattctgtt ggggacggcg ggccacgtct tgagcctggg cgccagcagc ttcgtggagg aggagcacca gacctggtac ttccttgtga acaccctgtg tctagctctg agccaagaaa cctacagaaa ctactttctg ggagatgacg gtgagcctcc gtgtggcctc tgtgtggaac aagggcatga cggggccaca gcagcgtggc aggacgggcc tggctgtgat gtcctggagc gagacaaagg ccacggaagc ccctctacct ccgaagtgct cagaggccgc gagaagtgga tggtgctggc cagtccgtgg ctaatactgg cctgctgccg gctgctgcgc tccctaaacc agacaggtgt gcagtgggct caccggcctg acctcggcca ctggctcacc agctctgacc acaaagccga gctctctgtc ctggctgccc tctccctcct cgtagttttt gtgctggtgc agagggggtg ctcccctgtg tccaaggctg ccctggcgct ggggctgctg ggcgtctact gctaccgggc ggccatcggg agtgtccggt tcccgtggcg gccggacagc aaggacattt ccaagggtat tattgaagct cgttttgttt atgtctttgt ccttggcatt ctgttcacgg gcaccaaaga cttacttaaa tctcaagtca ttgctgcaga cttcaaactc aagactgtag gtttatggga gatatatagt ggattagttc ttctggcagc cttgctcttt agaccacata atcttccggt cttagcattt agcctcttga ttcagactct aatgactaaa ttcatctgga agcccctgag acacgatgca gctgagatta ctgtgatgca ttattggttt ggtcaagcat tcttctattt tcagggcaac tccaacaaca ttgccaccgt ggacatctcc gcaggcttcg tgggcttaga cacctacgtg gaaatcccag ccgtgctcct gacagcgttt gggacgtacg cagggcctgt gctgtgggcc agccacttag tgcacttcct gagctcagaa acacgcagtg gttcagcact gagtcatgct tgcttctgct acgcactgat ttgttctatt ccagttttca cgtacatcgt tttggtgaca tctctgcgtt atcatttatt tatatggagt gtattttctc caaaacttct ctacgaggga atgcacctgc tcattacagc tgctgtctgt gtattcttca cggcaatgga tcaaaccaga ctcacacagt cttag. It is sometimes possible for the material contained within the vial of "PIGG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
